| Variant ID: vg1003873169 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3873169 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.53, A: 0.47, others allele: 0.00, population size: 90. )
TTAAATTAACAACATTCTAACTTTTTAGAAGTCAATTCATTCATTTATACCCTCAAAAAAAATATCACATAAATTATATAATTCATCAATTTCAAAAAAA[C/A]
TATCACATAAATTATATAATTCATCAATTTCAGCTATCCTAAACCTTAAGTACTACATATTTTTTTTCATGCGAGTCATGGTGATAAATTATTAAAGTCG
CGACTTTAATAATTTATCACCATGACTCGCATGAAAAAAAATATGTAGTACTTAAGGTTTAGGATAGCTGAAATTGATGAATTATATAATTTATGTGATA[G/T]
TTTTTTTGAAATTGATGAATTATATAATTTATGTGATATTTTTTTTGAGGGTATAAATGAATGAATTGACTTCTAAAAAGTTAGAATGTTGTTAATTTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.80% | 20.20% | 2.56% | 2.39% | NA |
| All Indica | 2759 | 82.60% | 14.60% | 2.79% | 0.00% | NA |
| All Japonica | 1512 | 63.00% | 28.70% | 1.52% | 6.81% | NA |
| Aus | 269 | 62.50% | 34.20% | 3.35% | 0.00% | NA |
| Indica I | 595 | 71.60% | 23.40% | 5.04% | 0.00% | NA |
| Indica II | 465 | 77.20% | 18.30% | 4.52% | 0.00% | NA |
| Indica III | 913 | 88.40% | 10.70% | 0.88% | 0.00% | NA |
| Indica Intermediate | 786 | 87.50% | 10.20% | 2.29% | 0.00% | NA |
| Temperate Japonica | 767 | 89.70% | 6.00% | 0.26% | 4.04% | NA |
| Tropical Japonica | 504 | 20.20% | 65.50% | 2.98% | 11.31% | NA |
| Japonica Intermediate | 241 | 67.20% | 24.10% | 2.49% | 6.22% | NA |
| VI/Aromatic | 96 | 71.90% | 9.40% | 9.38% | 9.38% | NA |
| Intermediate | 90 | 73.30% | 22.20% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003873169 | C -> A | LOC_Os10g07340.1 | downstream_gene_variant ; 1873.0bp to feature; MODIFIER | silent_mutation | Average:27.03; most accessible tissue: Zhenshan97 flower, score: 37.704 | N | N | N | N |
| vg1003873169 | C -> A | LOC_Os10g07340-LOC_Os10g07370 | intergenic_region ; MODIFIER | silent_mutation | Average:27.03; most accessible tissue: Zhenshan97 flower, score: 37.704 | N | N | N | N |
| vg1003873169 | C -> DEL | N | N | silent_mutation | Average:27.03; most accessible tissue: Zhenshan97 flower, score: 37.704 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003873169 | NA | 2.68E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003873169 | NA | 1.43E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003873169 | NA | 3.16E-08 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003873169 | NA | 2.35E-08 | mr1549 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003873169 | NA | 2.46E-06 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003873169 | NA | 1.80E-06 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003873169 | NA | 9.44E-06 | mr1936 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003873169 | NA | 3.42E-06 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003873169 | NA | 8.58E-09 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003873169 | NA | 4.73E-06 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |