\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003873169:

Variant ID: vg1003873169 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3873169
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.53, A: 0.47, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAATTAACAACATTCTAACTTTTTAGAAGTCAATTCATTCATTTATACCCTCAAAAAAAATATCACATAAATTATATAATTCATCAATTTCAAAAAAA[C/A]
TATCACATAAATTATATAATTCATCAATTTCAGCTATCCTAAACCTTAAGTACTACATATTTTTTTTCATGCGAGTCATGGTGATAAATTATTAAAGTCG

Reverse complement sequence

CGACTTTAATAATTTATCACCATGACTCGCATGAAAAAAAATATGTAGTACTTAAGGTTTAGGATAGCTGAAATTGATGAATTATATAATTTATGTGATA[G/T]
TTTTTTTGAAATTGATGAATTATATAATTTATGTGATATTTTTTTTGAGGGTATAAATGAATGAATTGACTTCTAAAAAGTTAGAATGTTGTTAATTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 20.20% 2.56% 2.39% NA
All Indica  2759 82.60% 14.60% 2.79% 0.00% NA
All Japonica  1512 63.00% 28.70% 1.52% 6.81% NA
Aus  269 62.50% 34.20% 3.35% 0.00% NA
Indica I  595 71.60% 23.40% 5.04% 0.00% NA
Indica II  465 77.20% 18.30% 4.52% 0.00% NA
Indica III  913 88.40% 10.70% 0.88% 0.00% NA
Indica Intermediate  786 87.50% 10.20% 2.29% 0.00% NA
Temperate Japonica  767 89.70% 6.00% 0.26% 4.04% NA
Tropical Japonica  504 20.20% 65.50% 2.98% 11.31% NA
Japonica Intermediate  241 67.20% 24.10% 2.49% 6.22% NA
VI/Aromatic  96 71.90% 9.40% 9.38% 9.38% NA
Intermediate  90 73.30% 22.20% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003873169 C -> A LOC_Os10g07340.1 downstream_gene_variant ; 1873.0bp to feature; MODIFIER silent_mutation Average:27.03; most accessible tissue: Zhenshan97 flower, score: 37.704 N N N N
vg1003873169 C -> A LOC_Os10g07340-LOC_Os10g07370 intergenic_region ; MODIFIER silent_mutation Average:27.03; most accessible tissue: Zhenshan97 flower, score: 37.704 N N N N
vg1003873169 C -> DEL N N silent_mutation Average:27.03; most accessible tissue: Zhenshan97 flower, score: 37.704 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003873169 NA 2.68E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169 NA 1.43E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169 NA 3.16E-08 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169 NA 2.35E-08 mr1549 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169 NA 2.46E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169 NA 1.80E-06 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169 NA 9.44E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169 NA 3.42E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169 NA 8.58E-09 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169 NA 4.73E-06 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251