Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1003873169:

Variant ID: vg1003873169 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3873169
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.53, A: 0.47, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TTAAATTAACAACATTCTAACTTTTTAGAAGTCAATTCATTCATTTATACCCTCAAAAAAAATATCACATAAATTATATAATTCATCAATTTCAAAAAAA[C/A]
TATCACATAAATTATATAATTCATCAATTTCAGCTATCCTAAACCTTAAGTACTACATATTTTTTTTCATGCGAGTCATGGTGATAAATTATTAAAGTCG

Reverse complement sequence

CGACTTTAATAATTTATCACCATGACTCGCATGAAAAAAAATATGTAGTACTTAAGGTTTAGGATAGCTGAAATTGATGAATTATATAATTTATGTGATA[G/T]
TTTTTTTGAAATTGATGAATTATATAATTTATGTGATATTTTTTTTGAGGGTATAAATGAATGAATTGACTTCTAAAAAGTTAGAATGTTGTTAATTTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.80%	20.20%	2.56%	2.39%	NA
All Indica	2759	82.60%	14.60%	2.79%	0.00%	NA
All Japonica	1512	63.00%	28.70%	1.52%	6.81%	NA
Aus	269	62.50%	34.20%	3.35%	0.00%	NA
Indica I	595	71.60%	23.40%	5.04%	0.00%	NA
Indica II	465	77.20%	18.30%	4.52%	0.00%	NA
Indica III	913	88.40%	10.70%	0.88%	0.00%	NA
Indica Intermediate	786	87.50%	10.20%	2.29%	0.00%	NA
Temperate Japonica	767	89.70%	6.00%	0.26%	4.04%	NA
Tropical Japonica	504	20.20%	65.50%	2.98%	11.31%	NA
Japonica Intermediate	241	67.20%	24.10%	2.49%	6.22%	NA
VI/Aromatic	96	71.90%	9.40%	9.38%	9.38%	NA
Intermediate	90	73.30%	22.20%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003873169	C -> A	LOC_Os10g07340.1	downstream_gene_variant ; 1873.0bp to feature; MODIFIER	silent_mutation	Average:27.03; most accessible tissue: Zhenshan97 flower, score: 37.704	N	N	N	N
vg1003873169	C -> A	LOC_Os10g07340-LOC_Os10g07370	intergenic_region ; MODIFIER	silent_mutation	Average:27.03; most accessible tissue: Zhenshan97 flower, score: 37.704	N	N	N	N
vg1003873169	C -> DEL	N	N	silent_mutation	Average:27.03; most accessible tissue: Zhenshan97 flower, score: 37.704	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003873169	NA	2.68E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169	NA	1.43E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169	NA	3.16E-08	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169	NA	2.35E-08	mr1549	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169	NA	2.46E-06	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169	NA	1.80E-06	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169	NA	9.44E-06	mr1936	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169	NA	3.42E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169	NA	8.58E-09	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003873169	NA	4.73E-06	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251