Variant ID: vg1003750840 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 3750840 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCTTGCCCATAACCGAGGGTGTGGCTATTCGAATAGTTTTTAACTCTGATAAGAGGTGTACAACTTTACCCACAAGACACAACCTCAACACGTGTTGCCA[C/T]
GCACCGGGTATCACCACGGTACTCAGATAGAGGTCCTGACAAGACTATCCATCTAGGTCTACCCAAAACAGGAGAACCCGCTGAGGTTTCACCGCCCGCC
GGCGGGCGGTGAAACCTCAGCGGGTTCTCCTGTTTTGGGTAGACCTAGATGGATAGTCTTGTCAGGACCTCTATCTGAGTACCGTGGTGATACCCGGTGC[G/A]
TGGCAACACGTGTTGAGGTTGTGTCTTGTGGGTAAAGTTGTACACCTCTTATCAGAGTTAAAAACTATTCGAATAGCCACACCCTCGGTTATGGGCAAGC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 76.40% | 5.70% | 2.18% | 15.70% | NA |
All Indica | 2759 | 67.30% | 3.30% | 3.44% | 25.99% | NA |
All Japonica | 1512 | 89.50% | 10.40% | 0.00% | 0.07% | NA |
Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
Indica I | 595 | 83.90% | 0.00% | 1.51% | 14.62% | NA |
Indica II | 465 | 74.40% | 1.70% | 2.15% | 21.72% | NA |
Indica III | 913 | 44.10% | 7.10% | 6.02% | 42.72% | NA |
Indica Intermediate | 786 | 77.40% | 2.30% | 2.67% | 17.68% | NA |
Temperate Japonica | 767 | 91.00% | 8.90% | 0.00% | 0.13% | NA |
Tropical Japonica | 504 | 86.10% | 13.90% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 56.20% | 19.80% | 3.12% | 20.83% | NA |
Intermediate | 90 | 88.90% | 3.30% | 3.33% | 4.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1003750840 | C -> T | LOC_Os10g07150.1 | 3_prime_UTR_variant ; 737.0bp to feature; MODIFIER | silent_mutation | Average:24.282; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
vg1003750840 | C -> T | LOC_Os10g07130.1 | upstream_gene_variant ; 4691.0bp to feature; MODIFIER | silent_mutation | Average:24.282; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
vg1003750840 | C -> T | LOC_Os10g07160.1 | downstream_gene_variant ; 4267.0bp to feature; MODIFIER | silent_mutation | Average:24.282; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
vg1003750840 | C -> T | LOC_Os10g07150.2 | intron_variant ; MODIFIER | silent_mutation | Average:24.282; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
vg1003750840 | C -> DEL | N | N | silent_mutation | Average:24.282; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1003750840 | NA | 7.95E-06 | mr1415_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003750840 | NA | 2.59E-06 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003750840 | NA | 6.86E-07 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003750840 | NA | 6.45E-07 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003750840 | 4.09E-09 | 5.77E-11 | mr1748_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |