\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003523062:

Variant ID: vg1003523062 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3523062
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTACCCAATCATTAAACTTGTATTATGGCGACCATAACTGTGCATGTCTTTATAGTATTTTTTTCCTAAAATATATTAAAATTATTTGTTAGAAA[C/T]
AAAATTAATCAAATGAATCTTTAGCTACGATGAGGGTTTCTTAGTAAATAGTTTTTACAATAGATGCAAATCGTAAATTATATGTATAACATTATACCTT

Reverse complement sequence

AAGGTATAATGTTATACATATAATTTACGATTTGCATCTATTGTAAAAACTATTTACTAAGAAACCCTCATCGTAGCTAAAGATTCATTTGATTAATTTT[G/A]
TTTCTAACAAATAATTTTAATATATTTTAGGAAAAAAATACTATAAAGACATGCACAGTTATGGTCGCCATAATACAAGTTTAATGATTGGGTAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 42.90% 0.30% 0.00% NA
All Indica  2759 50.80% 48.70% 0.47% 0.00% NA
All Japonica  1512 63.80% 36.20% 0.07% 0.00% NA
Aus  269 87.70% 12.30% 0.00% 0.00% NA
Indica I  595 47.60% 52.30% 0.17% 0.00% NA
Indica II  465 56.30% 43.00% 0.65% 0.00% NA
Indica III  913 55.50% 43.70% 0.77% 0.00% NA
Indica Intermediate  786 44.40% 55.30% 0.25% 0.00% NA
Temperate Japonica  767 91.80% 8.20% 0.00% 0.00% NA
Tropical Japonica  504 27.40% 72.40% 0.20% 0.00% NA
Japonica Intermediate  241 50.60% 49.40% 0.00% 0.00% NA
VI/Aromatic  96 36.50% 63.50% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003523062 C -> T LOC_Os10g06780.1 upstream_gene_variant ; 4086.0bp to feature; MODIFIER silent_mutation Average:27.58; most accessible tissue: Callus, score: 62.059 N N N N
vg1003523062 C -> T LOC_Os10g06760.1 downstream_gene_variant ; 4414.0bp to feature; MODIFIER silent_mutation Average:27.58; most accessible tissue: Callus, score: 62.059 N N N N
vg1003523062 C -> T LOC_Os10g06770.1 downstream_gene_variant ; 2729.0bp to feature; MODIFIER silent_mutation Average:27.58; most accessible tissue: Callus, score: 62.059 N N N N
vg1003523062 C -> T LOC_Os10g06760-LOC_Os10g06770 intergenic_region ; MODIFIER silent_mutation Average:27.58; most accessible tissue: Callus, score: 62.059 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003523062 NA 2.30E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003523062 1.41E-08 3.41E-11 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003523062 4.57E-08 1.78E-07 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003523062 4.20E-14 9.88E-18 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003523062 6.07E-16 2.36E-20 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003523062 1.47E-25 1.96E-33 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003523062 NA 8.90E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003523062 1.28E-10 4.80E-15 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003523062 2.15E-08 4.31E-11 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003523062 4.58E-17 9.53E-26 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003523062 1.70E-23 3.64E-25 mr1709_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003523062 6.93E-37 1.58E-50 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251