\
| Variant ID: vg1003523062 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3523062 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 117. )
TTTTTTTACCCAATCATTAAACTTGTATTATGGCGACCATAACTGTGCATGTCTTTATAGTATTTTTTTCCTAAAATATATTAAAATTATTTGTTAGAAA[C/T]
AAAATTAATCAAATGAATCTTTAGCTACGATGAGGGTTTCTTAGTAAATAGTTTTTACAATAGATGCAAATCGTAAATTATATGTATAACATTATACCTT
AAGGTATAATGTTATACATATAATTTACGATTTGCATCTATTGTAAAAACTATTTACTAAGAAACCCTCATCGTAGCTAAAGATTCATTTGATTAATTTT[G/A]
TTTCTAACAAATAATTTTAATATATTTTAGGAAAAAAATACTATAAAGACATGCACAGTTATGGTCGCCATAATACAAGTTTAATGATTGGGTAAAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.80% | 42.90% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 50.80% | 48.70% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 63.80% | 36.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 47.60% | 52.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 56.30% | 43.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 55.50% | 43.70% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 44.40% | 55.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 27.40% | 72.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 36.50% | 63.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 44.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003523062 | C -> T | LOC_Os10g06780.1 | upstream_gene_variant ; 4086.0bp to feature; MODIFIER | silent_mutation | Average:27.58; most accessible tissue: Callus, score: 62.059 | N | N | N | N |
| vg1003523062 | C -> T | LOC_Os10g06760.1 | downstream_gene_variant ; 4414.0bp to feature; MODIFIER | silent_mutation | Average:27.58; most accessible tissue: Callus, score: 62.059 | N | N | N | N |
| vg1003523062 | C -> T | LOC_Os10g06770.1 | downstream_gene_variant ; 2729.0bp to feature; MODIFIER | silent_mutation | Average:27.58; most accessible tissue: Callus, score: 62.059 | N | N | N | N |
| vg1003523062 | C -> T | LOC_Os10g06760-LOC_Os10g06770 | intergenic_region ; MODIFIER | silent_mutation | Average:27.58; most accessible tissue: Callus, score: 62.059 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003523062 | NA | 2.30E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003523062 | 1.41E-08 | 3.41E-11 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003523062 | 4.57E-08 | 1.78E-07 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003523062 | 4.20E-14 | 9.88E-18 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003523062 | 6.07E-16 | 2.36E-20 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003523062 | 1.47E-25 | 1.96E-33 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003523062 | NA | 8.90E-06 | mr1043_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003523062 | 1.28E-10 | 4.80E-15 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003523062 | 2.15E-08 | 4.31E-11 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003523062 | 4.58E-17 | 9.53E-26 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003523062 | 1.70E-23 | 3.64E-25 | mr1709_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003523062 | 6.93E-37 | 1.58E-50 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |