Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1003521634:

Variant ID: vg1003521634 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3521634
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GCCAACACATGGCAGTCAGACCGGCCCACTCGGAGGAAACTGGCAGACTTCCAAACTTTGGCAATTTTTCCTATTTTTATCCTAAGTGCCAAATTTATGT[G/A]
TAAATAAATTCTACTGCATTATTCCATTTGTACAATTTAATGCACAGGAACAAATTTCAATATGGCGCGCCAACATTTCAGGTACTAAAATATCACATTA

Reverse complement sequence

TAATGTGATATTTTAGTACCTGAAATGTTGGCGCGCCATATTGAAATTTGTTCCTGTGCATTAAATTGTACAAATGGAATAATGCAGTAGAATTTATTTA[C/T]
ACATAAATTTGGCACTTAGGATAAAAATAGGAAAAATTGCCAAAGTTTGGAAGTCTGCCAGTTTCCTCCGAGTGGGCCGGTCTGACTGCCATGTGTTGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	36.50%	0.17%	0.00%	NA
All Indica	2759	69.10%	30.60%	0.29%	0.00%	NA
All Japonica	1512	63.10%	36.90%	0.00%	0.00%	NA
Aus	269	8.90%	91.10%	0.00%	0.00%	NA
Indica I	595	78.80%	21.00%	0.17%	0.00%	NA
Indica II	465	56.30%	43.20%	0.43%	0.00%	NA
Indica III	913	67.10%	32.40%	0.44%	0.00%	NA
Indica Intermediate	786	71.50%	28.40%	0.13%	0.00%	NA
Temperate Japonica	767	91.30%	8.70%	0.00%	0.00%	NA
Tropical Japonica	504	28.60%	71.40%	0.00%	0.00%	NA
Japonica Intermediate	241	45.60%	54.40%	0.00%	0.00%	NA
VI/Aromatic	96	60.40%	39.60%	0.00%	0.00%	NA
Intermediate	90	58.90%	41.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003521634	G -> A	LOC_Os10g06760.1	downstream_gene_variant ; 2986.0bp to feature; MODIFIER	silent_mutation	Average:50.223; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1003521634	G -> A	LOC_Os10g06770.1	downstream_gene_variant ; 4157.0bp to feature; MODIFIER	silent_mutation	Average:50.223; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1003521634	G -> A	LOC_Os10g06760-LOC_Os10g06770	intergenic_region ; MODIFIER	silent_mutation	Average:50.223; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003521634	NA	2.12E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521634	NA	6.94E-06	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521634	NA	8.71E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521634	NA	3.18E-06	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521634	1.20E-08	1.34E-08	mr1709	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521634	3.22E-12	8.33E-15	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521634	NA	9.61E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521634	NA	1.13E-06	mr1291_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521634	2.42E-06	9.88E-10	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521634	3.22E-08	2.33E-09	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521634	NA	1.79E-07	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521634	3.23E-08	9.48E-11	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521634	8.38E-11	1.84E-13	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251