\
| Variant ID: vg1003521634 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3521634 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 90. )
GCCAACACATGGCAGTCAGACCGGCCCACTCGGAGGAAACTGGCAGACTTCCAAACTTTGGCAATTTTTCCTATTTTTATCCTAAGTGCCAAATTTATGT[G/A]
TAAATAAATTCTACTGCATTATTCCATTTGTACAATTTAATGCACAGGAACAAATTTCAATATGGCGCGCCAACATTTCAGGTACTAAAATATCACATTA
TAATGTGATATTTTAGTACCTGAAATGTTGGCGCGCCATATTGAAATTTGTTCCTGTGCATTAAATTGTACAAATGGAATAATGCAGTAGAATTTATTTA[C/T]
ACATAAATTTGGCACTTAGGATAAAAATAGGAAAAATTGCCAAAGTTTGGAAGTCTGCCAGTTTCCTCCGAGTGGGCCGGTCTGACTGCCATGTGTTGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.40% | 36.50% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 69.10% | 30.60% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 63.10% | 36.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 8.90% | 91.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 78.80% | 21.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 56.30% | 43.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 67.10% | 32.40% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 71.50% | 28.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 28.60% | 71.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 60.40% | 39.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 41.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003521634 | G -> A | LOC_Os10g06760.1 | downstream_gene_variant ; 2986.0bp to feature; MODIFIER | silent_mutation | Average:50.223; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1003521634 | G -> A | LOC_Os10g06770.1 | downstream_gene_variant ; 4157.0bp to feature; MODIFIER | silent_mutation | Average:50.223; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1003521634 | G -> A | LOC_Os10g06760-LOC_Os10g06770 | intergenic_region ; MODIFIER | silent_mutation | Average:50.223; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003521634 | NA | 2.12E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521634 | NA | 6.94E-06 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521634 | NA | 8.71E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521634 | NA | 3.18E-06 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521634 | 1.20E-08 | 1.34E-08 | mr1709 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521634 | 3.22E-12 | 8.33E-15 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521634 | NA | 9.61E-06 | mr1043_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521634 | NA | 1.13E-06 | mr1291_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521634 | 2.42E-06 | 9.88E-10 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521634 | 3.22E-08 | 2.33E-09 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521634 | NA | 1.79E-07 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521634 | 3.23E-08 | 9.48E-11 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521634 | 8.38E-11 | 1.84E-13 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |