\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003491099:

Variant ID: vg1003491099 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3491099
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTTTTGGTGTACCTATGAAATATATATAGATCAATTTGAAATGGAGGGAGTATAATTGATGGAGGTAGTACTGCGTAGTACTCCCTCCATCCCAATTT[G/A]
ATCATTCTCTAAGCAAATCTACACTAATACTATGAACTCCAAGATATCCATCATTCTGCAATTAATTTTCATCGATCAAGGTGCTCCACTTCGTATCCAA

Reverse complement sequence

TTGGATACGAAGTGGAGCACCTTGATCGATGAAAATTAATTGCAGAATGATGGATATCTTGGAGTTCATAGTATTAGTGTAGATTTGCTTAGAGAATGAT[C/T]
AAATTGGGATGGAGGGAGTACTACGCAGTACTACCTCCATCAATTATACTCCCTCCATTTCAAATTGATCTATATATATTTCATAGGTACACCAAAACCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 35.00% 0.17% 0.04% NA
All Indica  2759 53.60% 46.10% 0.29% 0.07% NA
All Japonica  1512 76.50% 23.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 46.40% 53.60% 0.00% 0.00% NA
Indica II  465 56.60% 43.00% 0.43% 0.00% NA
Indica III  913 64.10% 35.40% 0.55% 0.00% NA
Indica Intermediate  786 45.00% 54.60% 0.13% 0.25% NA
Temperate Japonica  767 62.60% 37.40% 0.00% 0.00% NA
Tropical Japonica  504 95.80% 4.20% 0.00% 0.00% NA
Japonica Intermediate  241 80.10% 19.90% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003491099 G -> A LOC_Os10g06730-LOC_Os10g06740 intergenic_region ; MODIFIER silent_mutation Average:52.829; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg1003491099 G -> DEL N N silent_mutation Average:52.829; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003491099 NA 3.07E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 NA 1.93E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 NA 3.42E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 5.93E-06 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 5.06E-09 1.43E-11 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 1.66E-19 1.43E-19 mr1547 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 1.17E-16 2.27E-20 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 NA 2.93E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 NA 3.13E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 3.54E-26 1.22E-34 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 4.23E-27 5.29E-36 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 NA 2.94E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 2.94E-07 NA mr1538_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 5.75E-10 4.54E-13 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 3.67E-15 2.69E-20 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 1.68E-17 2.14E-25 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 1.59E-50 6.17E-60 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 1.26E-43 6.78E-58 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 2.71E-10 5.49E-16 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003491099 NA 9.88E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251