\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003462033:

Variant ID: vg1003462033 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3462033
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, A: 0.44, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCAAACACTGCCTGGCACTCGAGTTCACTTAGGCATGTTCTCAGGGTTTTAACCAAACACTACCTTAAATTTAAGCCATGCCTGGTCAAGTAACTCTT[G/A]
TAAGCAAGCTCAGGCTATCCTCAGACATGAAAAATACGCAGACATGTTGCTCAGGGTAGCAACCAAACAGGCTCTCAATTCCGGATAGACATGTTCCACT

Reverse complement sequence

AGTGGAACATGTCTATCCGGAATTGAGAGCCTGTTTGGTTGCTACCCTGAGCAACATGTCTGCGTATTTTTCATGTCTGAGGATAGCCTGAGCTTGCTTA[C/T]
AAGAGTTACTTGACCAGGCATGGCTTAAATTTAAGGTAGTGTTTGGTTAAAACCCTGAGAACATGCCTAAGTGAACTCGAGTGCCAGGCAGTGTTTGGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 17.30% 3.32% 20.84% NA
All Indica  2759 46.70% 16.10% 3.01% 34.18% NA
All Japonica  1512 76.00% 23.60% 0.07% 0.33% NA
Aus  269 88.10% 0.00% 9.67% 2.23% NA
Indica I  595 39.00% 20.80% 1.01% 39.16% NA
Indica II  465 62.60% 13.80% 0.65% 23.01% NA
Indica III  913 36.30% 15.30% 6.79% 41.62% NA
Indica Intermediate  786 55.30% 14.80% 1.53% 28.37% NA
Temperate Japonica  767 61.80% 37.80% 0.00% 0.39% NA
Tropical Japonica  504 98.00% 1.80% 0.00% 0.20% NA
Japonica Intermediate  241 75.10% 24.10% 0.41% 0.41% NA
VI/Aromatic  96 29.20% 8.30% 42.71% 19.79% NA
Intermediate  90 72.20% 7.80% 6.67% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003462033 G -> A LOC_Os10g06680.1 upstream_gene_variant ; 795.0bp to feature; MODIFIER silent_mutation Average:56.794; most accessible tissue: Callus, score: 94.691 N N N N
vg1003462033 G -> A LOC_Os10g06660.1 downstream_gene_variant ; 4412.0bp to feature; MODIFIER silent_mutation Average:56.794; most accessible tissue: Callus, score: 94.691 N N N N
vg1003462033 G -> A LOC_Os10g06670.1 downstream_gene_variant ; 1636.0bp to feature; MODIFIER silent_mutation Average:56.794; most accessible tissue: Callus, score: 94.691 N N N N
vg1003462033 G -> A LOC_Os10g06690.1 downstream_gene_variant ; 2366.0bp to feature; MODIFIER silent_mutation Average:56.794; most accessible tissue: Callus, score: 94.691 N N N N
vg1003462033 G -> A LOC_Os10g06670-LOC_Os10g06680 intergenic_region ; MODIFIER silent_mutation Average:56.794; most accessible tissue: Callus, score: 94.691 N N N N
vg1003462033 G -> DEL N N silent_mutation Average:56.794; most accessible tissue: Callus, score: 94.691 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003462033 NA 3.06E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 NA 6.20E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 NA 4.09E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 NA 2.45E-07 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 4.59E-11 8.71E-13 mr1547 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 1.23E-08 2.06E-10 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 NA 2.43E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 NA 5.82E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 1.20E-11 5.57E-13 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 2.08E-10 4.38E-11 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 NA 7.34E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 NA 8.95E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 NA 1.55E-07 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 4.89E-09 9.18E-12 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 8.88E-10 2.14E-12 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 6.89E-19 3.28E-20 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 7.23E-12 4.30E-12 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 2.40E-11 4.03E-18 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003462033 NA 3.43E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251