\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003433058:

Variant ID: vg1003433058 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 3433058
Reference Allele: GAlternative Allele: GTACA,GTATTTTAGTACA,GTATA
Primary Allele: GSecondary Allele: GTACA

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.21, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTTGATAATAAAACAAATCACAGACAATAAATAATAATTTCATAATTTTTTGAATAAAATAAATGATCAATCGTTACAAATAAAAACTTAAAGCGAC[G/GTACA,GTATTTTAGTACA,GTATA]
GAGGCAGTGGTAAGATATGTATGGAAAAATGTTTCATGCAAACTGTAATGTAAACTCTCGTGAACCTGACCAAAAAATCATCAAAATACACAAAAATATC

Reverse complement sequence

GATATTTTTGTGTATTTTGATGATTTTTTGGTCAGGTTCACGAGAGTTTACATTACAGTTTGCATGAAACATTTTTCCATACATATCTTACCACTGCCTC[C/TGTAC,TGTACTAAAATAC,TATAC]
GTCGCTTTAAGTTTTTATTTGTAACGATTGATCATTTATTTTATTCAAAAAATTATGAAATTATTATTTATTGTCTGTGATTTGTTTTATTATCAAAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of GTACA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 25.20% 1.97% 1.04% GTATTTTAGTACA: 7.68%; GTATA: 0.02%
All Indica  2759 56.50% 38.70% 2.54% 1.78% GTATTTTAGTACA: 0.43%
All Japonica  1512 75.80% 0.50% 1.26% 0.00% GTATTTTAGTACA: 22.49%
Aus  269 88.10% 11.50% 0.00% 0.00% GTATA: 0.37%
Indica I  595 51.30% 43.50% 3.03% 0.67% GTATTTTAGTACA: 1.51%
Indica II  465 70.50% 24.50% 4.09% 0.86% NA
Indica III  913 45.30% 49.80% 2.08% 2.74% NA
Indica Intermediate  786 65.30% 30.50% 1.78% 2.04% GTATTTTAGTACA: 0.38%
Temperate Japonica  767 61.50% 0.40% 1.96% 0.00% GTATTTTAGTACA: 36.11%
Tropical Japonica  504 98.00% 0.20% 0.20% 0.00% GTATTTTAGTACA: 1.59%
Japonica Intermediate  241 74.70% 1.20% 1.24% 0.00% GTATTTTAGTACA: 22.82%
VI/Aromatic  96 26.00% 65.60% 1.04% 0.00% GTATTTTAGTACA: 7.29%
Intermediate  90 70.00% 22.20% 3.33% 0.00% GTATTTTAGTACA: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003433058 G -> GTATA LOC_Os10g06610.1 downstream_gene_variant ; 549.0bp to feature; MODIFIER silent_mutation Average:59.962; most accessible tissue: Callus, score: 84.011 N N N N
vg1003433058 G -> GTATA LOC_Os10g06620.1 downstream_gene_variant ; 1207.0bp to feature; MODIFIER silent_mutation Average:59.962; most accessible tissue: Callus, score: 84.011 N N N N
vg1003433058 G -> GTATA LOC_Os10g06610-LOC_Os10g06620 intergenic_region ; MODIFIER silent_mutation Average:59.962; most accessible tissue: Callus, score: 84.011 N N N N
vg1003433058 G -> GTATTTTAGTACA LOC_Os10g06610.1 downstream_gene_variant ; 549.0bp to feature; MODIFIER silent_mutation Average:59.962; most accessible tissue: Callus, score: 84.011 N N N N
vg1003433058 G -> GTATTTTAGTACA LOC_Os10g06620.1 downstream_gene_variant ; 1207.0bp to feature; MODIFIER silent_mutation Average:59.962; most accessible tissue: Callus, score: 84.011 N N N N
vg1003433058 G -> GTATTTTAGTACA LOC_Os10g06610-LOC_Os10g06620 intergenic_region ; MODIFIER silent_mutation Average:59.962; most accessible tissue: Callus, score: 84.011 N N N N
vg1003433058 G -> GTACA LOC_Os10g06610.1 downstream_gene_variant ; 549.0bp to feature; MODIFIER silent_mutation Average:59.962; most accessible tissue: Callus, score: 84.011 N N N N
vg1003433058 G -> GTACA LOC_Os10g06620.1 downstream_gene_variant ; 1207.0bp to feature; MODIFIER silent_mutation Average:59.962; most accessible tissue: Callus, score: 84.011 N N N N
vg1003433058 G -> GTACA LOC_Os10g06610-LOC_Os10g06620 intergenic_region ; MODIFIER silent_mutation Average:59.962; most accessible tissue: Callus, score: 84.011 N N N N
vg1003433058 G -> DEL N N silent_mutation Average:59.962; most accessible tissue: Callus, score: 84.011 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003433058 NA 2.69E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003433058 NA 3.14E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003433058 4.24E-07 5.85E-06 mr1360_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003433058 2.14E-08 8.03E-17 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251