Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1003433058:

Variant ID: vg1003433058 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 3433058
Reference Allele: G	Alternative Allele: GTACA,GTATTTTAGTACA,GTATA
Primary Allele: G	Secondary Allele: GTACA

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.21, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTTGATAATAAAACAAATCACAGACAATAAATAATAATTTCATAATTTTTTGAATAAAATAAATGATCAATCGTTACAAATAAAAACTTAAAGCGAC[G/GTACA,GTATTTTAGTACA,GTATA]
GAGGCAGTGGTAAGATATGTATGGAAAAATGTTTCATGCAAACTGTAATGTAAACTCTCGTGAACCTGACCAAAAAATCATCAAAATACACAAAAATATC

Reverse complement sequence

GATATTTTTGTGTATTTTGATGATTTTTTGGTCAGGTTCACGAGAGTTTACATTACAGTTTGCATGAAACATTTTTCCATACATATCTTACCACTGCCTC[C/TGTAC,TGTACTAAAATAC,TATAC]
GTCGCTTTAAGTTTTTATTTGTAACGATTGATCATTTATTTTATTCAAAAAATTATGAAATTATTATTTATTGTCTGTGATTTGTTTTATTATCAAAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of GTACA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.10%	25.20%	1.97%	1.04%	GTATTTTAGTACA: 7.68%; GTATA: 0.02%
All Indica	2759	56.50%	38.70%	2.54%	1.78%	GTATTTTAGTACA: 0.43%
All Japonica	1512	75.80%	0.50%	1.26%	0.00%	GTATTTTAGTACA: 22.49%
Aus	269	88.10%	11.50%	0.00%	0.00%	GTATA: 0.37%
Indica I	595	51.30%	43.50%	3.03%	0.67%	GTATTTTAGTACA: 1.51%
Indica II	465	70.50%	24.50%	4.09%	0.86%	NA
Indica III	913	45.30%	49.80%	2.08%	2.74%	NA
Indica Intermediate	786	65.30%	30.50%	1.78%	2.04%	GTATTTTAGTACA: 0.38%
Temperate Japonica	767	61.50%	0.40%	1.96%	0.00%	GTATTTTAGTACA: 36.11%
Tropical Japonica	504	98.00%	0.20%	0.20%	0.00%	GTATTTTAGTACA: 1.59%
Japonica Intermediate	241	74.70%	1.20%	1.24%	0.00%	GTATTTTAGTACA: 22.82%
VI/Aromatic	96	26.00%	65.60%	1.04%	0.00%	GTATTTTAGTACA: 7.29%
Intermediate	90	70.00%	22.20%	3.33%	0.00%	GTATTTTAGTACA: 4.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003433058	G -> GTATA	LOC_Os10g06610.1	downstream_gene_variant ; 549.0bp to feature; MODIFIER	silent_mutation	Average:59.962; most accessible tissue: Callus, score: 84.011	N	N	N	N
vg1003433058	G -> GTATA	LOC_Os10g06620.1	downstream_gene_variant ; 1207.0bp to feature; MODIFIER	silent_mutation	Average:59.962; most accessible tissue: Callus, score: 84.011	N	N	N	N
vg1003433058	G -> GTATA	LOC_Os10g06610-LOC_Os10g06620	intergenic_region ; MODIFIER	silent_mutation	Average:59.962; most accessible tissue: Callus, score: 84.011	N	N	N	N
vg1003433058	G -> GTATTTTAGTACA	LOC_Os10g06610.1	downstream_gene_variant ; 549.0bp to feature; MODIFIER	silent_mutation	Average:59.962; most accessible tissue: Callus, score: 84.011	N	N	N	N
vg1003433058	G -> GTATTTTAGTACA	LOC_Os10g06620.1	downstream_gene_variant ; 1207.0bp to feature; MODIFIER	silent_mutation	Average:59.962; most accessible tissue: Callus, score: 84.011	N	N	N	N
vg1003433058	G -> GTATTTTAGTACA	LOC_Os10g06610-LOC_Os10g06620	intergenic_region ; MODIFIER	silent_mutation	Average:59.962; most accessible tissue: Callus, score: 84.011	N	N	N	N
vg1003433058	G -> GTACA	LOC_Os10g06610.1	downstream_gene_variant ; 549.0bp to feature; MODIFIER	silent_mutation	Average:59.962; most accessible tissue: Callus, score: 84.011	N	N	N	N
vg1003433058	G -> GTACA	LOC_Os10g06620.1	downstream_gene_variant ; 1207.0bp to feature; MODIFIER	silent_mutation	Average:59.962; most accessible tissue: Callus, score: 84.011	N	N	N	N
vg1003433058	G -> GTACA	LOC_Os10g06610-LOC_Os10g06620	intergenic_region ; MODIFIER	silent_mutation	Average:59.962; most accessible tissue: Callus, score: 84.011	N	N	N	N
vg1003433058	G -> DEL	N	N	silent_mutation	Average:59.962; most accessible tissue: Callus, score: 84.011	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003433058	NA	2.69E-06	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003433058	NA	3.14E-07	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003433058	4.24E-07	5.85E-06	mr1360_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003433058	2.14E-08	8.03E-17	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251