\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003373930:

Variant ID: vg1003373930 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3373930
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTTGTTCCTGGATCAATGTAGTATTCCCTCCATTCAAAATATAGTAACCTAGAATTAGATGGGATGTATCCTAATACTACGAATCTGAACTGGGATA[C/T]
ATCGGTCGTAGGTTGCAAAATTCAGGGACAGAGAGAGTATTCCTTCTTGTTGTTCGAAGCCAAAAACGTGTCGCTGCCACTCCTGCCTGCTAGCATCGCC

Reverse complement sequence

GGCGATGCTAGCAGGCAGGAGTGGCAGCGACACGTTTTTGGCTTCGAACAACAAGAAGGAATACTCTCTCTGTCCCTGAATTTTGCAACCTACGACCGAT[G/A]
TATCCCAGTTCAGATTCGTAGTATTAGGATACATCCCATCTAATTCTAGGTTACTATATTTTGAATGGAGGGAATACTACATTGATCCAGGAACAAAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.00% 2.20% 0.83% 0.00% NA
All Indica  2759 94.90% 3.80% 1.38% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 87.60% 9.10% 3.36% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 98.10% 1.60% 0.22% 0.00% NA
Indica Intermediate  786 93.80% 4.30% 1.91% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003373930 C -> T LOC_Os10g06550.1 downstream_gene_variant ; 3935.0bp to feature; MODIFIER silent_mutation Average:64.374; most accessible tissue: Callus, score: 86.798 N N N N
vg1003373930 C -> T LOC_Os10g06560.1 downstream_gene_variant ; 3602.0bp to feature; MODIFIER silent_mutation Average:64.374; most accessible tissue: Callus, score: 86.798 N N N N
vg1003373930 C -> T LOC_Os10g06550-LOC_Os10g06560 intergenic_region ; MODIFIER silent_mutation Average:64.374; most accessible tissue: Callus, score: 86.798 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003373930 NA 2.30E-08 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003373930 NA 2.26E-09 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003373930 2.42E-06 NA mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003373930 NA 2.39E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003373930 NA 3.41E-09 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003373930 4.05E-10 NA mr1709_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251