Variant ID: vg1003150061 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 3150061 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 286. )
GCCAATTTGAGTTGTTGCGTTGTTCTATTAGTTTTTGTGTTGTTGAATTTTAGATTGCATCGTCGTGTTGAGTGCTGGTTTAGTTTTAGATTTAATTTTT[C/T]
GTTTTGAGTATTGCATCTGTTCCTCACTTAGGTTTAGGGTTCATCACTCAAATCTGTGTGAGTTTTACGTTTTGGGTCCAGCTTTTTTATCTCGTCGGTT
AACCGACGAGATAAAAAAGCTGGACCCAAAACGTAAAACTCACACAGATTTGAGTGATGAACCCTAAACCTAAGTGAGGAACAGATGCAATACTCAAAAC[G/A]
AAAAATTAAATCTAAAACTAAACCAGCACTCAACACGACGATGCAATCTAAAATTCAACAACACAAAAACTAATAGAACAACGCAACAACTCAAATTGGC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.70% | 1.30% | 0.99% | 0.00% | NA |
All Indica | 2759 | 96.10% | 2.20% | 1.70% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 90.10% | 4.00% | 5.88% | 0.00% | NA |
Indica II | 465 | 99.10% | 0.20% | 0.65% | 0.00% | NA |
Indica III | 913 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 97.20% | 1.70% | 1.15% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1003150061 | C -> T | LOC_Os10g06170.1 | upstream_gene_variant ; 4780.0bp to feature; MODIFIER | silent_mutation | Average:36.908; most accessible tissue: Zhenshan97 young leaf, score: 57.159 | N | N | N | N |
vg1003150061 | C -> T | LOC_Os10g06160-LOC_Os10g06170 | intergenic_region ; MODIFIER | silent_mutation | Average:36.908; most accessible tissue: Zhenshan97 young leaf, score: 57.159 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1003150061 | NA | 6.17E-09 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003150061 | NA | 1.02E-06 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003150061 | 8.96E-06 | 3.99E-07 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003150061 | NA | 3.50E-07 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003150061 | 7.90E-08 | 4.25E-08 | mr1004_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003150061 | NA | 2.21E-06 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003150061 | NA | 2.67E-07 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003150061 | NA | 2.04E-09 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |