\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003150061:

Variant ID: vg1003150061 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3150061
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAATTTGAGTTGTTGCGTTGTTCTATTAGTTTTTGTGTTGTTGAATTTTAGATTGCATCGTCGTGTTGAGTGCTGGTTTAGTTTTAGATTTAATTTTT[C/T]
GTTTTGAGTATTGCATCTGTTCCTCACTTAGGTTTAGGGTTCATCACTCAAATCTGTGTGAGTTTTACGTTTTGGGTCCAGCTTTTTTATCTCGTCGGTT

Reverse complement sequence

AACCGACGAGATAAAAAAGCTGGACCCAAAACGTAAAACTCACACAGATTTGAGTGATGAACCCTAAACCTAAGTGAGGAACAGATGCAATACTCAAAAC[G/A]
AAAAATTAAATCTAAAACTAAACCAGCACTCAACACGACGATGCAATCTAAAATTCAACAACACAAAAACTAATAGAACAACGCAACAACTCAAATTGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.70% 1.30% 0.99% 0.00% NA
All Indica  2759 96.10% 2.20% 1.70% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 90.10% 4.00% 5.88% 0.00% NA
Indica II  465 99.10% 0.20% 0.65% 0.00% NA
Indica III  913 97.50% 2.50% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 1.70% 1.15% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003150061 C -> T LOC_Os10g06170.1 upstream_gene_variant ; 4780.0bp to feature; MODIFIER silent_mutation Average:36.908; most accessible tissue: Zhenshan97 young leaf, score: 57.159 N N N N
vg1003150061 C -> T LOC_Os10g06160-LOC_Os10g06170 intergenic_region ; MODIFIER silent_mutation Average:36.908; most accessible tissue: Zhenshan97 young leaf, score: 57.159 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003150061 NA 6.17E-09 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003150061 NA 1.02E-06 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003150061 8.96E-06 3.99E-07 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003150061 NA 3.50E-07 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003150061 7.90E-08 4.25E-08 mr1004_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003150061 NA 2.21E-06 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003150061 NA 2.67E-07 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003150061 NA 2.04E-09 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251