\
| Variant ID: vg1003149497 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3149497 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTATGCACAAATAAGTTCGGAAATTACTAGTGAATTTCCGGGCGTGACATTATGTCGTGGGCTTAGCCTAAGGGGATGTGTGCCCTAGGGCAACCCTAG[G/T]
ATGTCCCTAATCATATTTATTCAGTAGCTGTCATAGTTTAGAGTCGAGTTTTGTTTAGATTGATCTGTCAAGAACAGTTTTGCCGCTAAATCAGTTTGTG
CACAAACTGATTTAGCGGCAAAACTGTTCTTGACAGATCAATCTAAACAAAACTCGACTCTAAACTATGACAGCTACTGAATAAATATGATTAGGGACAT[C/A]
CTAGGGTTGCCCTAGGGCACACATCCCCTTAGGCTAAGCCCACGACATAATGTCACGCCCGGAAATTCACTAGTAATTTCCGAACTTATTTGTGCATAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.70% | 11.20% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 84.50% | 15.30% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.70% | 18.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 86.70% | 13.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 84.30% | 15.30% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 60.40% | 39.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003149497 | G -> T | LOC_Os10g06160-LOC_Os10g06170 | intergenic_region ; MODIFIER | silent_mutation | Average:19.824; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003149497 | NA | 3.14E-07 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003149497 | 6.79E-08 | 9.52E-07 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003149497 | 6.88E-09 | 1.93E-10 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003149497 | 4.39E-10 | 2.44E-13 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003149497 | 1.17E-10 | 2.78E-11 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003149497 | NA | 2.95E-09 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003149497 | 1.28E-09 | 1.80E-12 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003149497 | 7.98E-12 | 5.37E-15 | mr1547_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003149497 | 2.62E-13 | 6.11E-13 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003149497 | 1.61E-11 | 8.47E-12 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003149497 | NA | 9.68E-06 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |