\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003149497:

Variant ID: vg1003149497 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3149497
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATGCACAAATAAGTTCGGAAATTACTAGTGAATTTCCGGGCGTGACATTATGTCGTGGGCTTAGCCTAAGGGGATGTGTGCCCTAGGGCAACCCTAG[G/T]
ATGTCCCTAATCATATTTATTCAGTAGCTGTCATAGTTTAGAGTCGAGTTTTGTTTAGATTGATCTGTCAAGAACAGTTTTGCCGCTAAATCAGTTTGTG

Reverse complement sequence

CACAAACTGATTTAGCGGCAAAACTGTTCTTGACAGATCAATCTAAACAAAACTCGACTCTAAACTATGACAGCTACTGAATAAATATGATTAGGGACAT[C/A]
CTAGGGTTGCCCTAGGGCACACATCCCCTTAGGCTAAGCCCACGACATAATGTCACGCCCGGAAATTCACTAGTAATTTCCGAACTTATTTGTGCATAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 11.20% 0.13% 0.00% NA
All Indica  2759 84.50% 15.30% 0.22% 0.00% NA
All Japonica  1512 97.80% 2.20% 0.00% 0.00% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 81.70% 18.00% 0.34% 0.00% NA
Indica II  465 86.70% 13.10% 0.22% 0.00% NA
Indica III  913 84.30% 15.30% 0.33% 0.00% NA
Indica Intermediate  786 85.60% 14.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 93.30% 6.70% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 60.40% 39.60% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003149497 G -> T LOC_Os10g06160-LOC_Os10g06170 intergenic_region ; MODIFIER silent_mutation Average:19.824; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003149497 NA 3.14E-07 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003149497 6.79E-08 9.52E-07 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003149497 6.88E-09 1.93E-10 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003149497 4.39E-10 2.44E-13 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003149497 1.17E-10 2.78E-11 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003149497 NA 2.95E-09 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003149497 1.28E-09 1.80E-12 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003149497 7.98E-12 5.37E-15 mr1547_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003149497 2.62E-13 6.11E-13 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003149497 1.61E-11 8.47E-12 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003149497 NA 9.68E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251