\
| Variant ID: vg1003131226 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3131226 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, A: 0.43, others allele: 0.00, population size: 100. )
TACGAGACAATTGTTCACTATAGTTCATTTATTTATAGTGATTGCTTTAGTGTTTGATTGGCACTAGAGTAGTTATTAATTGCGTAGACGCGGTGTCTGG[G/A]
TAATTAATCTTCAGTGGTTGCTGCGTATCCCATAGTACATTTGAGGTAGGTGTAGAGGTGGTGACAGCCCTAGACACTATTTCTCTAGACACTGTTAAAC
GTTTAACAGTGTCTAGAGAAATAGTGTCTAGGGCTGTCACCACCTCTACACCTACCTCAAATGTACTATGGGATACGCAGCAACCACTGAAGATTAATTA[C/T]
CCAGACACCGCGTCTACGCAATTAATAACTACTCTAGTGCCAATCAAACACTAAAGCAATCACTATAAATAAATGAACTATAGTGAACAATTGTCTCGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.70% | 30.00% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 53.40% | 46.20% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 49.10% | 50.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 56.30% | 43.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 61.70% | 38.00% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 45.30% | 54.20% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 24.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003131226 | G -> A | LOC_Os10g06140.1 | upstream_gene_variant ; 3954.0bp to feature; MODIFIER | silent_mutation | Average:42.681; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg1003131226 | G -> A | LOC_Os10g06140-LOC_Os10g06160 | intergenic_region ; MODIFIER | silent_mutation | Average:42.681; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003131226 | 4.85E-08 | NA | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003131226 | 7.80E-10 | 2.31E-12 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003131226 | 3.18E-17 | 5.16E-13 | mr1547 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003131226 | 5.88E-18 | 2.22E-22 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003131226 | 1.10E-22 | 1.49E-31 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003131226 | 4.38E-23 | 1.91E-33 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003131226 | 7.03E-10 | 6.56E-14 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003131226 | 5.71E-16 | 4.26E-19 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003131226 | 3.19E-18 | 1.63E-27 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003131226 | 2.02E-39 | 1.91E-43 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003131226 | 5.58E-34 | 4.00E-54 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |