\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003131226:

Variant ID: vg1003131226 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3131226
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, A: 0.43, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TACGAGACAATTGTTCACTATAGTTCATTTATTTATAGTGATTGCTTTAGTGTTTGATTGGCACTAGAGTAGTTATTAATTGCGTAGACGCGGTGTCTGG[G/A]
TAATTAATCTTCAGTGGTTGCTGCGTATCCCATAGTACATTTGAGGTAGGTGTAGAGGTGGTGACAGCCCTAGACACTATTTCTCTAGACACTGTTAAAC

Reverse complement sequence

GTTTAACAGTGTCTAGAGAAATAGTGTCTAGGGCTGTCACCACCTCTACACCTACCTCAAATGTACTATGGGATACGCAGCAACCACTGAAGATTAATTA[C/T]
CCAGACACCGCGTCTACGCAATTAATAACTACTCTAGTGCCAATCAAACACTAAAGCAATCACTATAAATAAATGAACTATAGTGAACAATTGTCTCGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 30.00% 0.28% 0.00% NA
All Indica  2759 53.40% 46.20% 0.40% 0.00% NA
All Japonica  1512 96.80% 3.20% 0.00% 0.00% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 49.10% 50.80% 0.17% 0.00% NA
Indica II  465 56.30% 43.00% 0.65% 0.00% NA
Indica III  913 61.70% 38.00% 0.33% 0.00% NA
Indica Intermediate  786 45.30% 54.20% 0.51% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 90.90% 9.10% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 73.30% 24.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003131226 G -> A LOC_Os10g06140.1 upstream_gene_variant ; 3954.0bp to feature; MODIFIER silent_mutation Average:42.681; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg1003131226 G -> A LOC_Os10g06140-LOC_Os10g06160 intergenic_region ; MODIFIER silent_mutation Average:42.681; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003131226 4.85E-08 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226 7.80E-10 2.31E-12 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226 3.18E-17 5.16E-13 mr1547 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226 5.88E-18 2.22E-22 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226 1.10E-22 1.49E-31 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226 4.38E-23 1.91E-33 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226 7.03E-10 6.56E-14 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226 5.71E-16 4.26E-19 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226 3.19E-18 1.63E-27 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226 2.02E-39 1.91E-43 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003131226 5.58E-34 4.00E-54 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251