\
| Variant ID: vg1003128682 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3128682 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 100. )
GAAAACGAATTAAATCTTCTCCCCTCCCTCCCTTGGGCTCGGCCCAAGTCTCCTTCCCCCTCCACTGGCCGCTCTCTTCTTCTCCTCCTTCCTTTGGGTC[G/A]
TCAGCCCAGCCGGCCTCTCTCTCGTGCGAAGTTCGTTTCGCCTCCCTCCTCTACCCGAGCCGCCAATAGGTGGGCCCCACCTGTCGGGGTTATCCCCTTC
GAAGGGGATAACCCCGACAGGTGGGGCCCACCTATTGGCGGCTCGGGTAGAGGAGGGAGGCGAAACGAACTTCGCACGAGAGAGAGGCCGGCTGGGCTGA[C/T]
GACCCAAAGGAAGGAGGAGAAGAAGAGAGCGGCCAGTGGAGGGGGAAGGAGACTTGGGCCGAGCCCAAGGGAGGGAGGGGAGAAGATTTAATTCGTTTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.50% | 40.70% | 0.17% | 0.59% | NA |
| All Indica | 2759 | 31.50% | 67.20% | 0.29% | 1.01% | NA |
| All Japonica | 1512 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 22.90% | 76.10% | 0.34% | 0.67% | NA |
| Indica II | 465 | 44.50% | 54.80% | 0.22% | 0.43% | NA |
| Indica III | 913 | 31.80% | 65.70% | 0.44% | 2.08% | NA |
| Indica Intermediate | 786 | 29.90% | 69.60% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003128682 | G -> A | LOC_Os10g06140.1 | upstream_gene_variant ; 1410.0bp to feature; MODIFIER | silent_mutation | Average:61.745; most accessible tissue: Zhenshan97 young leaf, score: 80.848 | N | N | N | N |
| vg1003128682 | G -> A | LOC_Os10g06140-LOC_Os10g06160 | intergenic_region ; MODIFIER | silent_mutation | Average:61.745; most accessible tissue: Zhenshan97 young leaf, score: 80.848 | N | N | N | N |
| vg1003128682 | G -> DEL | N | N | silent_mutation | Average:61.745; most accessible tissue: Zhenshan97 young leaf, score: 80.848 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003128682 | 8.80E-06 | 2.30E-06 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003128682 | NA | 6.89E-07 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003128682 | 3.07E-16 | 6.36E-11 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003128682 | 7.77E-14 | 1.15E-17 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003128682 | NA | 1.22E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003128682 | NA | 1.99E-08 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003128682 | 1.20E-06 | 3.51E-06 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003128682 | 5.23E-07 | 2.94E-08 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003128682 | 6.18E-22 | 1.86E-15 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003128682 | 3.89E-16 | 3.52E-17 | mr1709_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |