\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003128682:

Variant ID: vg1003128682 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3128682
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAACGAATTAAATCTTCTCCCCTCCCTCCCTTGGGCTCGGCCCAAGTCTCCTTCCCCCTCCACTGGCCGCTCTCTTCTTCTCCTCCTTCCTTTGGGTC[G/A]
TCAGCCCAGCCGGCCTCTCTCTCGTGCGAAGTTCGTTTCGCCTCCCTCCTCTACCCGAGCCGCCAATAGGTGGGCCCCACCTGTCGGGGTTATCCCCTTC

Reverse complement sequence

GAAGGGGATAACCCCGACAGGTGGGGCCCACCTATTGGCGGCTCGGGTAGAGGAGGGAGGCGAAACGAACTTCGCACGAGAGAGAGGCCGGCTGGGCTGA[C/T]
GACCCAAAGGAAGGAGGAGAAGAAGAGAGCGGCCAGTGGAGGGGGAAGGAGACTTGGGCCGAGCCCAAGGGAGGGAGGGGAGAAGATTTAATTCGTTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 40.70% 0.17% 0.59% NA
All Indica  2759 31.50% 67.20% 0.29% 1.01% NA
All Japonica  1512 98.60% 1.40% 0.00% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 22.90% 76.10% 0.34% 0.67% NA
Indica II  465 44.50% 54.80% 0.22% 0.43% NA
Indica III  913 31.80% 65.70% 0.44% 2.08% NA
Indica Intermediate  786 29.90% 69.60% 0.13% 0.38% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 2.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003128682 G -> A LOC_Os10g06140.1 upstream_gene_variant ; 1410.0bp to feature; MODIFIER silent_mutation Average:61.745; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg1003128682 G -> A LOC_Os10g06140-LOC_Os10g06160 intergenic_region ; MODIFIER silent_mutation Average:61.745; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg1003128682 G -> DEL N N silent_mutation Average:61.745; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003128682 8.80E-06 2.30E-06 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682 NA 6.89E-07 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682 3.07E-16 6.36E-11 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682 7.77E-14 1.15E-17 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682 NA 1.22E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682 NA 1.99E-08 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682 1.20E-06 3.51E-06 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682 5.23E-07 2.94E-08 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682 6.18E-22 1.86E-15 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682 3.89E-16 3.52E-17 mr1709_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251