Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1003128682:

Variant ID: vg1003128682 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3128682
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAACGAATTAAATCTTCTCCCCTCCCTCCCTTGGGCTCGGCCCAAGTCTCCTTCCCCCTCCACTGGCCGCTCTCTTCTTCTCCTCCTTCCTTTGGGTC[G/A]
TCAGCCCAGCCGGCCTCTCTCTCGTGCGAAGTTCGTTTCGCCTCCCTCCTCTACCCGAGCCGCCAATAGGTGGGCCCCACCTGTCGGGGTTATCCCCTTC

Reverse complement sequence

GAAGGGGATAACCCCGACAGGTGGGGCCCACCTATTGGCGGCTCGGGTAGAGGAGGGAGGCGAAACGAACTTCGCACGAGAGAGAGGCCGGCTGGGCTGA[C/T]
GACCCAAAGGAAGGAGGAGAAGAAGAGAGCGGCCAGTGGAGGGGGAAGGAGACTTGGGCCGAGCCCAAGGGAGGGAGGGGAGAAGATTTAATTCGTTTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.50%	40.70%	0.17%	0.59%	NA
All Indica	2759	31.50%	67.20%	0.29%	1.01%	NA
All Japonica	1512	98.60%	1.40%	0.00%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	22.90%	76.10%	0.34%	0.67%	NA
Indica II	465	44.50%	54.80%	0.22%	0.43%	NA
Indica III	913	31.80%	65.70%	0.44%	2.08%	NA
Indica Intermediate	786	29.90%	69.60%	0.13%	0.38%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	97.40%	2.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003128682	G -> A	LOC_Os10g06140.1	upstream_gene_variant ; 1410.0bp to feature; MODIFIER	silent_mutation	Average:61.745; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg1003128682	G -> A	LOC_Os10g06140-LOC_Os10g06160	intergenic_region ; MODIFIER	silent_mutation	Average:61.745; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg1003128682	G -> DEL	N	N	silent_mutation	Average:61.745; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003128682	8.80E-06	2.30E-06	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682	NA	6.89E-07	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682	3.07E-16	6.36E-11	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682	7.77E-14	1.15E-17	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682	NA	1.22E-06	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682	NA	1.99E-08	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682	1.20E-06	3.51E-06	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682	5.23E-07	2.94E-08	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682	6.18E-22	1.86E-15	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128682	3.89E-16	3.52E-17	mr1709_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251