Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003128189:

Variant ID: vg1003128189 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3128189
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.53, A: 0.48, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTGTCATATATTTTGAGTGGAGTACAATGGTGCAAATATATTTTTAAAATAATATACAGTTTAAAAGATAAAAGTTATCAAAGAGGTTTAGAAAAATG[T/A]
GCACTATTGTTTTTTTTAGCTAAAGAGGATTCATATGTGAGATAGAGTGGTCGTTGCTTTAACCAAACTAGCGACCGGTAACTGTGTAGTCGTGTCCTGG

Reverse complement sequence

CCAGGACACGACTACACAGTTACCGGTCGCTAGTTTGGTTAAAGCAACGACCACTCTATCTCACATATGAATCCTCTTTAGCTAAAAAAAACAATAGTGC[A/T]
CATTTTTCTAAACCTCTTTGATAACTTTTATCTTTTAAACTGTATATTATTTTAAAAATATATTTGCACCATTGTACTCCACTCAAAATATATGACAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.70%	30.10%	0.19%	0.00%	NA
All Indica	2759	53.40%	46.40%	0.25%	0.00%	NA
All Japonica	1512	96.80%	3.20%	0.00%	0.00%	NA
Aus	269	91.40%	8.60%	0.00%	0.00%	NA
Indica I	595	48.70%	50.90%	0.34%	0.00%	NA
Indica II	465	56.80%	42.80%	0.43%	0.00%	NA
Indica III	913	61.40%	38.40%	0.11%	0.00%	NA
Indica Intermediate	786	45.40%	54.30%	0.25%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	90.90%	9.10%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	50.00%	50.00%	0.00%	0.00%	NA
Intermediate	90	72.20%	25.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003128189	T -> A	LOC_Os10g06140.1	upstream_gene_variant ; 917.0bp to feature; MODIFIER	silent_mutation	Average:29.889; most accessible tissue: Callus, score: 59.472	N	N	N	N
vg1003128189	T -> A	LOC_Os10g06140-LOC_Os10g06160	intergenic_region ; MODIFIER	silent_mutation	Average:29.889; most accessible tissue: Callus, score: 59.472	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003128189	2.81E-07	NA	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189	3.27E-09	3.63E-12	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189	2.01E-16	7.16E-13	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189	4.20E-17	3.10E-22	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189	2.30E-25	6.56E-34	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189	5.70E-26	1.31E-36	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189	3.76E-10	1.00E-14	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189	5.87E-16	1.74E-19	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189	1.70E-18	2.70E-28	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189	4.11E-44	2.66E-46	mr1709_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189	1.39E-38	4.23E-59	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251