\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003128189:

Variant ID: vg1003128189 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3128189
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.53, A: 0.48, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTGTCATATATTTTGAGTGGAGTACAATGGTGCAAATATATTTTTAAAATAATATACAGTTTAAAAGATAAAAGTTATCAAAGAGGTTTAGAAAAATG[T/A]
GCACTATTGTTTTTTTTAGCTAAAGAGGATTCATATGTGAGATAGAGTGGTCGTTGCTTTAACCAAACTAGCGACCGGTAACTGTGTAGTCGTGTCCTGG

Reverse complement sequence

CCAGGACACGACTACACAGTTACCGGTCGCTAGTTTGGTTAAAGCAACGACCACTCTATCTCACATATGAATCCTCTTTAGCTAAAAAAAACAATAGTGC[A/T]
CATTTTTCTAAACCTCTTTGATAACTTTTATCTTTTAAACTGTATATTATTTTAAAAATATATTTGCACCATTGTACTCCACTCAAAATATATGACAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 30.10% 0.19% 0.00% NA
All Indica  2759 53.40% 46.40% 0.25% 0.00% NA
All Japonica  1512 96.80% 3.20% 0.00% 0.00% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 48.70% 50.90% 0.34% 0.00% NA
Indica II  465 56.80% 42.80% 0.43% 0.00% NA
Indica III  913 61.40% 38.40% 0.11% 0.00% NA
Indica Intermediate  786 45.40% 54.30% 0.25% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 90.90% 9.10% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 72.20% 25.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003128189 T -> A LOC_Os10g06140.1 upstream_gene_variant ; 917.0bp to feature; MODIFIER silent_mutation Average:29.889; most accessible tissue: Callus, score: 59.472 N N N N
vg1003128189 T -> A LOC_Os10g06140-LOC_Os10g06160 intergenic_region ; MODIFIER silent_mutation Average:29.889; most accessible tissue: Callus, score: 59.472 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003128189 2.81E-07 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189 3.27E-09 3.63E-12 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189 2.01E-16 7.16E-13 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189 4.20E-17 3.10E-22 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189 2.30E-25 6.56E-34 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189 5.70E-26 1.31E-36 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189 3.76E-10 1.00E-14 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189 5.87E-16 1.74E-19 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189 1.70E-18 2.70E-28 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189 4.11E-44 2.66E-46 mr1709_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003128189 1.39E-38 4.23E-59 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251