\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003093102:

Variant ID: vg1003093102 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3093102
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.22, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ACATAAAATGATTGTTGATATGATTTTGGATATATTTTAACATGTTCTTCTAGATTTATATATAAAATTAAACTTATTTTAGTATGGAGAGTGTATGTCC[G/A]
AGTCCGAATATACTTTAATGTAGCATAAAAAGAATCATTTTTAAACCATGTCACTAAATAGCACCAACACTACTCAGTACTTGAATGACATGACATCATT

Reverse complement sequence

AATGATGTCATGTCATTCAAGTACTGAGTAGTGTTGGTGCTATTTAGTGACATGGTTTAAAAATGATTCTTTTTATGCTACATTAAAGTATATTCGGACT[C/T]
GGACATACACTCTCCATACTAAAATAAGTTTAATTTTATATATAAATCTAGAAGAACATGTTAAAATATATCCAAAATCATATCAACAATCATTTTATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.00% 30.30% 0.15% 0.61% NA
All Indica  2759 73.20% 25.50% 0.25% 1.05% NA
All Japonica  1512 73.50% 26.50% 0.00% 0.00% NA
Aus  269 7.10% 92.90% 0.00% 0.00% NA
Indica I  595 78.70% 20.80% 0.34% 0.17% NA
Indica II  465 56.10% 42.80% 0.43% 0.65% NA
Indica III  913 78.00% 19.60% 0.11% 2.30% NA
Indica Intermediate  786 73.70% 25.60% 0.25% 0.51% NA
Temperate Japonica  767 62.50% 37.50% 0.00% 0.00% NA
Tropical Japonica  504 90.10% 9.90% 0.00% 0.00% NA
Japonica Intermediate  241 74.30% 25.70% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003093102 G -> A LOC_Os10g06090.1 intron_variant ; MODIFIER silent_mutation Average:38.723; most accessible tissue: Minghui63 root, score: 47.894 N N N N
vg1003093102 G -> DEL N N silent_mutation Average:38.723; most accessible tissue: Minghui63 root, score: 47.894 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003093102 NA 4.98E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 NA 2.23E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 NA 2.93E-06 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 7.09E-09 5.32E-09 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 1.21E-06 2.22E-08 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 NA 1.86E-08 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 NA 4.47E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 NA 3.43E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 1.87E-15 3.41E-22 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 3.41E-14 3.93E-19 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 NA 4.51E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 NA 4.59E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 NA 2.98E-08 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 1.49E-07 4.22E-10 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 2.02E-08 1.27E-09 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 2.15E-26 1.05E-36 mr1709_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 2.05E-16 3.13E-19 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093102 9.89E-12 1.73E-20 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251