Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1003083837:

Variant ID: vg1003083837 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3083837
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

CAATACGGGTATTCCTCCACATTCGTATATAATCCTAAGAAATTTTCGTGGTATGGGTACTCCTCCGTATTCATTTCCGATCAGATATCCATGACTTATT[G/A]
TCGTAAGGAACTCGATAATCAGAGGTGGTCTCTCGAAACACCAGGAGGGCATAGTTAGGGGGTATTGGCTACATGATTATATACTAGTAAGTGTCTGGTG

Reverse complement sequence

CACCAGACACTTACTAGTATATAATCATGTAGCCAATACCCCCTAACTATGCCCTCCTGGTGTTTCGAGAGACCACCTCTGATTATCGAGTTCCTTACGA[C/T]
AATAAGTCATGGATATCTGATCGGAAATGAATACGGAGGAGTACCCATACCACGAAAATTTCTTAGGATTATATACGAATGTGGAGGAATACCCGTATTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.50%	0.80%	0.72%	0.00%	NA
All Indica	2759	97.40%	1.40%	1.20%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	93.40%	4.70%	1.85%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	98.20%	0.00%	1.75%	0.00%	NA
Indica Intermediate	786	98.20%	1.10%	0.64%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003083837	G -> A	LOC_Os10g06070.1	upstream_gene_variant ; 1835.0bp to feature; MODIFIER	silent_mutation	Average:45.022; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N
vg1003083837	G -> A	LOC_Os10g06080.1	downstream_gene_variant ; 727.0bp to feature; MODIFIER	silent_mutation	Average:45.022; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N
vg1003083837	G -> A	LOC_Os10g06070-LOC_Os10g06080	intergenic_region ; MODIFIER	silent_mutation	Average:45.022; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003083837	NA	7.77E-07	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003083837	NA	8.81E-06	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003083837	NA	5.27E-07	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003083837	NA	3.91E-07	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003083837	7.15E-07	3.99E-07	mr1004_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003083837	NA	5.95E-06	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003083837	NA	1.43E-07	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003083837	9.08E-08	2.08E-09	mr1709_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251