\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003083837:

Variant ID: vg1003083837 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3083837
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


CAATACGGGTATTCCTCCACATTCGTATATAATCCTAAGAAATTTTCGTGGTATGGGTACTCCTCCGTATTCATTTCCGATCAGATATCCATGACTTATT[G/A]
TCGTAAGGAACTCGATAATCAGAGGTGGTCTCTCGAAACACCAGGAGGGCATAGTTAGGGGGTATTGGCTACATGATTATATACTAGTAAGTGTCTGGTG

Reverse complement sequence

CACCAGACACTTACTAGTATATAATCATGTAGCCAATACCCCCTAACTATGCCCTCCTGGTGTTTCGAGAGACCACCTCTGATTATCGAGTTCCTTACGA[C/T]
AATAAGTCATGGATATCTGATCGGAAATGAATACGGAGGAGTACCCATACCACGAAAATTTCTTAGGATTATATACGAATGTGGAGGAATACCCGTATTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.50% 0.80% 0.72% 0.00% NA
All Indica  2759 97.40% 1.40% 1.20% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.40% 4.70% 1.85% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 98.20% 0.00% 1.75% 0.00% NA
Indica Intermediate  786 98.20% 1.10% 0.64% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003083837 G -> A LOC_Os10g06070.1 upstream_gene_variant ; 1835.0bp to feature; MODIFIER silent_mutation Average:45.022; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg1003083837 G -> A LOC_Os10g06080.1 downstream_gene_variant ; 727.0bp to feature; MODIFIER silent_mutation Average:45.022; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg1003083837 G -> A LOC_Os10g06070-LOC_Os10g06080 intergenic_region ; MODIFIER silent_mutation Average:45.022; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003083837 NA 7.77E-07 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003083837 NA 8.81E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003083837 NA 5.27E-07 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003083837 NA 3.91E-07 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003083837 7.15E-07 3.99E-07 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003083837 NA 5.95E-06 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003083837 NA 1.43E-07 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003083837 9.08E-08 2.08E-09 mr1709_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251