\
| Variant ID: vg1003045443 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3045443 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 254. )
AATATGCATTACTGTACAGCAATCTGGAAATTAGCACAGGCTGAAACTGGACAGTTCCCAATTGAAGCCCGTGCTTTATTTGATATATTTGCCTACCTAT[T/C]
TATCATATATCTTAGTTAATCTAAGTCGATTATTTAAATTTACTTATATCGGTCAGATCTTTTCTAGGGTTTTGCCAGTATCGGCTAAATTGTTTTGTCG
CGACAAAACAATTTAGCCGATACTGGCAAAACCCTAGAAAAGATCTGACCGATATAAGTAAATTTAAATAATCGACTTAGATTAACTAAGATATATGATA[A/G]
ATAGGTAGGCAAATATATCAAATAAAGCACGGGCTTCAATTGGGAACTGTCCAGTTTCAGCCTGTGCTAATTTCCAGATTGCTGTACAGTAATGCATATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.40% | 21.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 63.60% | 36.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 55.50% | 44.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 56.40% | 43.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003045443 | T -> C | LOC_Os10g06010.1 | downstream_gene_variant ; 1027.0bp to feature; MODIFIER | silent_mutation | Average:42.602; most accessible tissue: Callus, score: 70.089 | N | N | N | N |
| vg1003045443 | T -> C | LOC_Os10g06000-LOC_Os10g06010 | intergenic_region ; MODIFIER | silent_mutation | Average:42.602; most accessible tissue: Callus, score: 70.089 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003045443 | 8.48E-11 | NA | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003045443 | 2.83E-11 | 2.68E-13 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003045443 | 4.23E-19 | 2.58E-23 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003045443 | 1.35E-16 | 2.10E-22 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003045443 | 5.15E-52 | 5.97E-60 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003045443 | 1.91E-46 | 5.61E-74 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003045443 | NA | 1.10E-06 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003045443 | NA | 9.07E-07 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003045443 | NA | 1.09E-06 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003045443 | 1.92E-11 | NA | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003045443 | 6.39E-14 | 2.46E-20 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003045443 | 6.75E-20 | 3.14E-25 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003045443 | 5.79E-20 | 4.48E-28 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003045443 | 2.83E-94 | 1.22E-108 | mr1709_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003045443 | 2.29E-76 | 1.35E-124 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |