\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003045443:

Variant ID: vg1003045443 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3045443
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


AATATGCATTACTGTACAGCAATCTGGAAATTAGCACAGGCTGAAACTGGACAGTTCCCAATTGAAGCCCGTGCTTTATTTGATATATTTGCCTACCTAT[T/C]
TATCATATATCTTAGTTAATCTAAGTCGATTATTTAAATTTACTTATATCGGTCAGATCTTTTCTAGGGTTTTGCCAGTATCGGCTAAATTGTTTTGTCG

Reverse complement sequence

CGACAAAACAATTTAGCCGATACTGGCAAAACCCTAGAAAAGATCTGACCGATATAAGTAAATTTAAATAATCGACTTAGATTAACTAAGATATATGATA[A/G]
ATAGGTAGGCAAATATATCAAATAAAGCACGGGCTTCAATTGGGAACTGTCCAGTTTCAGCCTGTGCTAATTTCCAGATTGCTGTACAGTAATGCATATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 21.60% 0.04% 0.00% NA
All Indica  2759 63.60% 36.40% 0.04% 0.00% NA
All Japonica  1512 99.60% 0.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 55.50% 44.50% 0.00% 0.00% NA
Indica II  465 75.50% 24.50% 0.00% 0.00% NA
Indica III  913 56.40% 43.50% 0.11% 0.00% NA
Indica Intermediate  786 71.00% 29.00% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003045443 T -> C LOC_Os10g06010.1 downstream_gene_variant ; 1027.0bp to feature; MODIFIER silent_mutation Average:42.602; most accessible tissue: Callus, score: 70.089 N N N N
vg1003045443 T -> C LOC_Os10g06000-LOC_Os10g06010 intergenic_region ; MODIFIER silent_mutation Average:42.602; most accessible tissue: Callus, score: 70.089 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003045443 8.48E-11 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443 2.83E-11 2.68E-13 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443 4.23E-19 2.58E-23 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443 1.35E-16 2.10E-22 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443 5.15E-52 5.97E-60 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443 1.91E-46 5.61E-74 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443 NA 1.10E-06 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443 NA 9.07E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443 NA 1.09E-06 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443 1.92E-11 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443 6.39E-14 2.46E-20 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443 6.75E-20 3.14E-25 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443 5.79E-20 4.48E-28 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443 2.83E-94 1.22E-108 mr1709_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003045443 2.29E-76 1.35E-124 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251