\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002989121:

Variant ID: vg1002989121 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2989121
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATAAGGGTCATCTGTGATGGGCGCTAGTTGTGGCCCGATTGAGATAGGTCATCTGTGACGGGCTATAGTTTGACTGGTCGTCTGGGTCAAAGCTATCG[G/A]
TGACGGGCTTTACTTAGGTCCCGATTGAGATAGATTCATCCGTAACGGCCGTTTGCCCGATTGAGATAACTCTTCACATCAGTGACTTCTAGCCTGTGAC

Reverse complement sequence

GTCACAGGCTAGAAGTCACTGATGTGAAGAGTTATCTCAATCGGGCAAACGGCCGTTACGGATGAATCTATCTCAATCGGGACCTAAGTAAAGCCCGTCA[C/T]
CGATAGCTTTGACCCAGACGACCAGTCAAACTATAGCCCGTCACAGATGACCTATCTCAATCGGGCCACAACTAGCGCCCATCACAGATGACCCTTATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.40% 14.30% 6.39% 36.99% NA
All Indica  2759 28.80% 1.20% 10.55% 59.41% NA
All Japonica  1512 58.90% 39.70% 0.00% 1.32% NA
Aus  269 91.40% 3.00% 1.86% 3.72% NA
Indica I  595 16.30% 0.30% 8.57% 74.79% NA
Indica II  465 46.90% 0.00% 6.67% 46.45% NA
Indica III  913 27.80% 1.80% 14.24% 56.19% NA
Indica Intermediate  786 28.80% 2.00% 10.05% 59.16% NA
Temperate Japonica  767 87.60% 11.90% 0.00% 0.52% NA
Tropical Japonica  504 15.10% 82.50% 0.00% 2.38% NA
Japonica Intermediate  241 59.30% 39.00% 0.00% 1.66% NA
VI/Aromatic  96 27.10% 14.60% 2.08% 56.25% NA
Intermediate  90 48.90% 18.90% 4.44% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002989121 G -> A LOC_Os10g05930.1 upstream_gene_variant ; 1776.0bp to feature; MODIFIER silent_mutation Average:14.492; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1002989121 G -> A LOC_Os10g05910-LOC_Os10g05930 intergenic_region ; MODIFIER silent_mutation Average:14.492; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1002989121 G -> DEL N N silent_mutation Average:14.492; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002989121 NA 2.45E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 7.87E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 5.80E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 1.79E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 4.24E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 1.49E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 1.68E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 1.08E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 1.10E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 8.98E-07 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 1.05E-08 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 6.16E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 2.63E-06 NA mr1620 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 3.06E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 9.12E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 3.76E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 4.87E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 4.27E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 4.39E-15 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 3.85E-06 mr1991 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 1.27E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 4.55E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002989121 NA 9.30E-14 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251