Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002940641:

Variant ID: vg1002940641 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2940641
Reference Allele: A	Alternative Allele: G,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGCCTGTGCCTGTGCTGTGTCGATGCGTGTGCTAAACTGCTGAGGAACAAGTTCACTTTTGGTCCCTTACCTTGTCGTCGAGTCAGAAATTCGTCTCT[A/G,C]
AACCACAAAACAGATTCAGTGTATCCCCCAATATACATAAAACCAATGCAAACGAGATTCCTCGACAGTATTATTCCTAGTTTTCACGTTAGCTAACATG

Reverse complement sequence

CATGTTAGCTAACGTGAAAACTAGGAATAATACTGTCGAGGAATCTCGTTTGCATTGGTTTTATGTATATTGGGGGATACACTGAATCTGTTTTGTGGTT[T/C,G]
AGAGACGAATTTCTGACTCGACGACAAGGTAAGGGACCAAAAGTGAACTTGTTCCTCAGCAGTTTAGCACACGCATCGACACAGCACAGGCACAGGCATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.30%	19.60%	1.12%	48.58%	C: 4.36%
All Indica	2759	11.00%	2.10%	1.41%	81.44%	C: 4.02%
All Japonica	1512	45.50%	53.00%	0.07%	1.19%	C: 0.20%
Aus	269	76.20%	11.90%	0.74%	0.00%	C: 11.15%
Indica I	595	2.50%	3.40%	2.18%	91.93%	NA
Indica II	465	31.00%	2.20%	0.00%	66.67%	C: 0.22%
Indica III	913	4.80%	0.50%	2.08%	81.60%	C: 10.95%
Indica Intermediate	786	12.70%	3.10%	0.89%	82.06%	C: 1.27%
Temperate Japonica	767	13.20%	86.20%	0.13%	0.52%	NA
Tropical Japonica	504	89.90%	7.50%	0.00%	2.58%	NA
Japonica Intermediate	241	55.60%	42.70%	0.00%	0.41%	C: 1.24%
VI/Aromatic	96	16.70%	9.40%	9.38%	5.21%	C: 59.38%
Intermediate	90	36.70%	26.70%	2.22%	28.89%	C: 5.56%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002940641	A -> C	LOC_Os10g05810.1	upstream_gene_variant ; 838.0bp to feature; MODIFIER	silent_mutation	Average:32.138; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg1002940641	A -> C	LOC_Os10g05820.1	downstream_gene_variant ; 1160.0bp to feature; MODIFIER	silent_mutation	Average:32.138; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg1002940641	A -> C	LOC_Os10g05810-LOC_Os10g05820	intergenic_region ; MODIFIER	silent_mutation	Average:32.138; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg1002940641	A -> G	LOC_Os10g05810.1	upstream_gene_variant ; 838.0bp to feature; MODIFIER	silent_mutation	Average:32.138; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg1002940641	A -> G	LOC_Os10g05820.1	downstream_gene_variant ; 1160.0bp to feature; MODIFIER	silent_mutation	Average:32.138; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg1002940641	A -> G	LOC_Os10g05810-LOC_Os10g05820	intergenic_region ; MODIFIER	silent_mutation	Average:32.138; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg1002940641	A -> DEL	N	N	silent_mutation	Average:32.138; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002940641	NA	1.29E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	3.39E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	6.68E-06	mr1272	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	5.80E-07	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	3.19E-06	mr1550	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	6.69E-10	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	3.46E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	1.98E-06	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	4.81E-06	1.08E-06	mr1349_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	3.99E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	8.03E-06	mr1355_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	4.17E-06	mr1462_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	2.16E-06	mr1472_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	6.39E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	2.18E-06	mr1544_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	9.00E-06	mr1717_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	NA	1.54E-07	mr1899_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641	3.71E-06	1.16E-07	mr1899_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251