\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002940641:

Variant ID: vg1002940641 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2940641
Reference Allele: AAlternative Allele: G,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGCCTGTGCCTGTGCTGTGTCGATGCGTGTGCTAAACTGCTGAGGAACAAGTTCACTTTTGGTCCCTTACCTTGTCGTCGAGTCAGAAATTCGTCTCT[A/G,C]
AACCACAAAACAGATTCAGTGTATCCCCCAATATACATAAAACCAATGCAAACGAGATTCCTCGACAGTATTATTCCTAGTTTTCACGTTAGCTAACATG

Reverse complement sequence

CATGTTAGCTAACGTGAAAACTAGGAATAATACTGTCGAGGAATCTCGTTTGCATTGGTTTTATGTATATTGGGGGATACACTGAATCTGTTTTGTGGTT[T/C,G]
AGAGACGAATTTCTGACTCGACGACAAGGTAAGGGACCAAAAGTGAACTTGTTCCTCAGCAGTTTAGCACACGCATCGACACAGCACAGGCACAGGCATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.30% 19.60% 1.12% 48.58% C: 4.36%
All Indica  2759 11.00% 2.10% 1.41% 81.44% C: 4.02%
All Japonica  1512 45.50% 53.00% 0.07% 1.19% C: 0.20%
Aus  269 76.20% 11.90% 0.74% 0.00% C: 11.15%
Indica I  595 2.50% 3.40% 2.18% 91.93% NA
Indica II  465 31.00% 2.20% 0.00% 66.67% C: 0.22%
Indica III  913 4.80% 0.50% 2.08% 81.60% C: 10.95%
Indica Intermediate  786 12.70% 3.10% 0.89% 82.06% C: 1.27%
Temperate Japonica  767 13.20% 86.20% 0.13% 0.52% NA
Tropical Japonica  504 89.90% 7.50% 0.00% 2.58% NA
Japonica Intermediate  241 55.60% 42.70% 0.00% 0.41% C: 1.24%
VI/Aromatic  96 16.70% 9.40% 9.38% 5.21% C: 59.38%
Intermediate  90 36.70% 26.70% 2.22% 28.89% C: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002940641 A -> C LOC_Os10g05810.1 upstream_gene_variant ; 838.0bp to feature; MODIFIER silent_mutation Average:32.138; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg1002940641 A -> C LOC_Os10g05820.1 downstream_gene_variant ; 1160.0bp to feature; MODIFIER silent_mutation Average:32.138; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg1002940641 A -> C LOC_Os10g05810-LOC_Os10g05820 intergenic_region ; MODIFIER silent_mutation Average:32.138; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg1002940641 A -> G LOC_Os10g05810.1 upstream_gene_variant ; 838.0bp to feature; MODIFIER silent_mutation Average:32.138; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg1002940641 A -> G LOC_Os10g05820.1 downstream_gene_variant ; 1160.0bp to feature; MODIFIER silent_mutation Average:32.138; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg1002940641 A -> G LOC_Os10g05810-LOC_Os10g05820 intergenic_region ; MODIFIER silent_mutation Average:32.138; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg1002940641 A -> DEL N N silent_mutation Average:32.138; most accessible tissue: Minghui63 root, score: 68.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002940641 NA 1.29E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 3.39E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 6.68E-06 mr1272 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 5.80E-07 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 3.19E-06 mr1550 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 6.69E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 3.46E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 1.98E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 4.81E-06 1.08E-06 mr1349_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 3.99E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 8.03E-06 mr1355_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 4.17E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 2.16E-06 mr1472_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 6.39E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 2.18E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 9.00E-06 mr1717_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 NA 1.54E-07 mr1899_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940641 3.71E-06 1.16E-07 mr1899_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251