\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002920760:

Variant ID: vg1002920760 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2920760
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAACACATAGTGGATCGTTCATCTTATTCAAAAACTTTTGTGAAATATGTAAAACTATATGTATCCATATAAGTATATTTAACAATGAATCAAATGATAG[G/A]
AAAAGAATTAATAATTACTTAAATTTTTTTTAATAAGATGAATGGTTAAACATATTTAAAAAAGTCAATGGCATCGAATATTTAGAAACGGAGGAAGTAA

Reverse complement sequence

TTACTTCCTCCGTTTCTAAATATTCGATGCCATTGACTTTTTTAAATATGTTTAACCATTCATCTTATTAAAAAAAATTTAAGTAATTATTAATTCTTTT[C/T]
CTATCATTTGATTCATTGTTAAATATACTTATATGGATACATATAGTTTTACATATTTCACAAAAGTTTTTGAATAAGATGAACGATCCACTATGTGTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 2.60% 1.14% 23.09% NA
All Indica  2759 87.40% 3.20% 0.18% 9.24% NA
All Japonica  1512 54.70% 2.30% 3.04% 39.95% NA
Aus  269 26.40% 0.00% 0.37% 73.23% NA
Indica I  595 98.30% 0.00% 0.00% 1.68% NA
Indica II  465 71.20% 0.20% 0.22% 28.39% NA
Indica III  913 87.10% 9.00% 0.11% 3.83% NA
Indica Intermediate  786 88.90% 0.80% 0.38% 9.92% NA
Temperate Japonica  767 79.70% 4.60% 5.08% 10.69% NA
Tropical Japonica  504 13.10% 0.00% 0.99% 85.91% NA
Japonica Intermediate  241 62.20% 0.00% 0.83% 36.93% NA
VI/Aromatic  96 86.50% 0.00% 0.00% 13.54% NA
Intermediate  90 73.30% 0.00% 2.22% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002920760 G -> A LOC_Os10g05790.1 downstream_gene_variant ; 1006.0bp to feature; MODIFIER silent_mutation Average:48.713; most accessible tissue: Callus, score: 87.155 N N N N
vg1002920760 G -> A LOC_Os10g05800.2 downstream_gene_variant ; 4474.0bp to feature; MODIFIER silent_mutation Average:48.713; most accessible tissue: Callus, score: 87.155 N N N N
vg1002920760 G -> A LOC_Os10g05800.1 downstream_gene_variant ; 4623.0bp to feature; MODIFIER silent_mutation Average:48.713; most accessible tissue: Callus, score: 87.155 N N N N
vg1002920760 G -> A LOC_Os10g05780-LOC_Os10g05790 intergenic_region ; MODIFIER silent_mutation Average:48.713; most accessible tissue: Callus, score: 87.155 N N N N
vg1002920760 G -> DEL N N silent_mutation Average:48.713; most accessible tissue: Callus, score: 87.155 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002920760 NA 1.95E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002920760 9.97E-07 9.97E-07 mr1284 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002920760 NA 7.10E-06 mr1397 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002920760 2.66E-06 2.66E-06 mr1955 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002920760 2.20E-06 2.20E-06 mr1992 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002920760 NA 1.03E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251