Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1002920760:

Variant ID: vg1002920760 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2920760
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAACACATAGTGGATCGTTCATCTTATTCAAAAACTTTTGTGAAATATGTAAAACTATATGTATCCATATAAGTATATTTAACAATGAATCAAATGATAG[G/A]
AAAAGAATTAATAATTACTTAAATTTTTTTTAATAAGATGAATGGTTAAACATATTTAAAAAAGTCAATGGCATCGAATATTTAGAAACGGAGGAAGTAA

Reverse complement sequence

TTACTTCCTCCGTTTCTAAATATTCGATGCCATTGACTTTTTTAAATATGTTTAACCATTCATCTTATTAAAAAAAATTTAAGTAATTATTAATTCTTTT[C/T]
CTATCATTTGATTCATTGTTAAATATACTTATATGGATACATATAGTTTTACATATTTCACAAAAGTTTTTGAATAAGATGAACGATCCACTATGTGTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.10%	2.60%	1.14%	23.09%	NA
All Indica	2759	87.40%	3.20%	0.18%	9.24%	NA
All Japonica	1512	54.70%	2.30%	3.04%	39.95%	NA
Aus	269	26.40%	0.00%	0.37%	73.23%	NA
Indica I	595	98.30%	0.00%	0.00%	1.68%	NA
Indica II	465	71.20%	0.20%	0.22%	28.39%	NA
Indica III	913	87.10%	9.00%	0.11%	3.83%	NA
Indica Intermediate	786	88.90%	0.80%	0.38%	9.92%	NA
Temperate Japonica	767	79.70%	4.60%	5.08%	10.69%	NA
Tropical Japonica	504	13.10%	0.00%	0.99%	85.91%	NA
Japonica Intermediate	241	62.20%	0.00%	0.83%	36.93%	NA
VI/Aromatic	96	86.50%	0.00%	0.00%	13.54%	NA
Intermediate	90	73.30%	0.00%	2.22%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002920760	G -> A	LOC_Os10g05790.1	downstream_gene_variant ; 1006.0bp to feature; MODIFIER	silent_mutation	Average:48.713; most accessible tissue: Callus, score: 87.155	N	N	N	N
vg1002920760	G -> A	LOC_Os10g05800.2	downstream_gene_variant ; 4474.0bp to feature; MODIFIER	silent_mutation	Average:48.713; most accessible tissue: Callus, score: 87.155	N	N	N	N
vg1002920760	G -> A	LOC_Os10g05800.1	downstream_gene_variant ; 4623.0bp to feature; MODIFIER	silent_mutation	Average:48.713; most accessible tissue: Callus, score: 87.155	N	N	N	N
vg1002920760	G -> A	LOC_Os10g05780-LOC_Os10g05790	intergenic_region ; MODIFIER	silent_mutation	Average:48.713; most accessible tissue: Callus, score: 87.155	N	N	N	N
vg1002920760	G -> DEL	N	N	silent_mutation	Average:48.713; most accessible tissue: Callus, score: 87.155	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002920760	NA	1.95E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002920760	9.97E-07	9.97E-07	mr1284	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002920760	NA	7.10E-06	mr1397	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002920760	2.66E-06	2.66E-06	mr1955	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002920760	2.20E-06	2.20E-06	mr1992	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002920760	NA	1.03E-07	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251