\
| Variant ID: vg1002920760 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2920760 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAACACATAGTGGATCGTTCATCTTATTCAAAAACTTTTGTGAAATATGTAAAACTATATGTATCCATATAAGTATATTTAACAATGAATCAAATGATAG[G/A]
AAAAGAATTAATAATTACTTAAATTTTTTTTAATAAGATGAATGGTTAAACATATTTAAAAAAGTCAATGGCATCGAATATTTAGAAACGGAGGAAGTAA
TTACTTCCTCCGTTTCTAAATATTCGATGCCATTGACTTTTTTAAATATGTTTAACCATTCATCTTATTAAAAAAAATTTAAGTAATTATTAATTCTTTT[C/T]
CTATCATTTGATTCATTGTTAAATATACTTATATGGATACATATAGTTTTACATATTTCACAAAAGTTTTTGAATAAGATGAACGATCCACTATGTGTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.10% | 2.60% | 1.14% | 23.09% | NA |
| All Indica | 2759 | 87.40% | 3.20% | 0.18% | 9.24% | NA |
| All Japonica | 1512 | 54.70% | 2.30% | 3.04% | 39.95% | NA |
| Aus | 269 | 26.40% | 0.00% | 0.37% | 73.23% | NA |
| Indica I | 595 | 98.30% | 0.00% | 0.00% | 1.68% | NA |
| Indica II | 465 | 71.20% | 0.20% | 0.22% | 28.39% | NA |
| Indica III | 913 | 87.10% | 9.00% | 0.11% | 3.83% | NA |
| Indica Intermediate | 786 | 88.90% | 0.80% | 0.38% | 9.92% | NA |
| Temperate Japonica | 767 | 79.70% | 4.60% | 5.08% | 10.69% | NA |
| Tropical Japonica | 504 | 13.10% | 0.00% | 0.99% | 85.91% | NA |
| Japonica Intermediate | 241 | 62.20% | 0.00% | 0.83% | 36.93% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 0.00% | 13.54% | NA |
| Intermediate | 90 | 73.30% | 0.00% | 2.22% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002920760 | G -> A | LOC_Os10g05790.1 | downstream_gene_variant ; 1006.0bp to feature; MODIFIER | silent_mutation | Average:48.713; most accessible tissue: Callus, score: 87.155 | N | N | N | N |
| vg1002920760 | G -> A | LOC_Os10g05800.2 | downstream_gene_variant ; 4474.0bp to feature; MODIFIER | silent_mutation | Average:48.713; most accessible tissue: Callus, score: 87.155 | N | N | N | N |
| vg1002920760 | G -> A | LOC_Os10g05800.1 | downstream_gene_variant ; 4623.0bp to feature; MODIFIER | silent_mutation | Average:48.713; most accessible tissue: Callus, score: 87.155 | N | N | N | N |
| vg1002920760 | G -> A | LOC_Os10g05780-LOC_Os10g05790 | intergenic_region ; MODIFIER | silent_mutation | Average:48.713; most accessible tissue: Callus, score: 87.155 | N | N | N | N |
| vg1002920760 | G -> DEL | N | N | silent_mutation | Average:48.713; most accessible tissue: Callus, score: 87.155 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002920760 | NA | 1.95E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002920760 | 9.97E-07 | 9.97E-07 | mr1284 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002920760 | NA | 7.10E-06 | mr1397 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002920760 | 2.66E-06 | 2.66E-06 | mr1955 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002920760 | 2.20E-06 | 2.20E-06 | mr1992 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002920760 | NA | 1.03E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |