Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1002880362:

Variant ID: vg1002880362 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2880362
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, C: 0.13, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

GCCGGAAAGAGTAGAGGTAACTCAGAAGGTTACTGACTCTGCTCTTACCCCCCATCCTAGAAAGAGGGGGAGACCTCCGGGTGCTCGGGACAAGGTTCCG[T/C]
GGAGACGTCCGCAGAGACAAGAACCTGAGCCACTTGTTCCACTCAAAGAATCGATTGAAGAAGCTCAACCTGAAGTTGAGAAAGCCCCAGAAGAGGCAAC

Reverse complement sequence

GTTGCCTCTTCTGGGGCTTTCTCAACTTCAGGTTGAGCTTCTTCAATCGATTCTTTGAGTGGAACAAGTGGCTCAGGTTCTTGTCTCTGCGGACGTCTCC[A/G]
CGGAACCTTGTCCCGAGCACCCGGAGGTCTCCCCCTCTTTCTAGGATGGGGGGTAAGAGCAGAGTCAGTAACCTTCTGAGTTACCTCTACTCTTTCCGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.80%	20.30%	1.02%	52.92%	NA
All Indica	2759	12.00%	1.40%	1.27%	85.32%	NA
All Japonica	1512	42.40%	56.20%	0.00%	1.46%	NA
Aus	269	75.10%	12.60%	2.23%	10.04%	NA
Indica I	595	2.20%	1.20%	0.50%	96.13%	NA
Indica II	465	31.60%	1.30%	1.51%	65.59%	NA
Indica III	913	7.10%	0.90%	1.75%	90.25%	NA
Indica Intermediate	786	13.40%	2.40%	1.15%	83.08%	NA
Temperate Japonica	767	11.30%	88.00%	0.00%	0.65%	NA
Tropical Japonica	504	89.30%	8.10%	0.00%	2.58%	NA
Japonica Intermediate	241	43.20%	55.20%	0.00%	1.66%	NA
VI/Aromatic	96	15.60%	11.50%	4.17%	68.75%	NA
Intermediate	90	33.30%	27.80%	3.33%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002880362	T -> C	LOC_Os10g05710.1	missense_variant ; p.Trp634Arg; MODERATE	nonsynonymous_codon ; W634R	Average:12.962; most accessible tissue: Callus, score: 26.869	unknown	unknown	TOLERATED	1.00
vg1002880362	T -> DEL	LOC_Os10g05710.1	N	frameshift_variant	Average:12.962; most accessible tissue: Callus, score: 26.869	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002880362	NA	1.05E-07	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	4.20E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	4.13E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	1.96E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	6.79E-07	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	3.13E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	7.22E-07	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	1.49E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	9.89E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	1.63E-14	mr1540	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	7.75E-10	mr1543	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	1.75E-10	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	3.45E-07	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	5.97E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	7.28E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	3.88E-07	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	9.45E-16	mr1732	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	9.93E-07	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	2.16E-06	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	1.76E-06	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	6.88E-09	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	5.09E-07	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	1.18E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	4.96E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	3.21E-08	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	1.28E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362	NA	3.89E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251