\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002880362:

Variant ID: vg1002880362 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2880362
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, C: 0.13, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGGAAAGAGTAGAGGTAACTCAGAAGGTTACTGACTCTGCTCTTACCCCCCATCCTAGAAAGAGGGGGAGACCTCCGGGTGCTCGGGACAAGGTTCCG[T/C]
GGAGACGTCCGCAGAGACAAGAACCTGAGCCACTTGTTCCACTCAAAGAATCGATTGAAGAAGCTCAACCTGAAGTTGAGAAAGCCCCAGAAGAGGCAAC

Reverse complement sequence

GTTGCCTCTTCTGGGGCTTTCTCAACTTCAGGTTGAGCTTCTTCAATCGATTCTTTGAGTGGAACAAGTGGCTCAGGTTCTTGTCTCTGCGGACGTCTCC[A/G]
CGGAACCTTGTCCCGAGCACCCGGAGGTCTCCCCCTCTTTCTAGGATGGGGGGTAAGAGCAGAGTCAGTAACCTTCTGAGTTACCTCTACTCTTTCCGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.80% 20.30% 1.02% 52.92% NA
All Indica  2759 12.00% 1.40% 1.27% 85.32% NA
All Japonica  1512 42.40% 56.20% 0.00% 1.46% NA
Aus  269 75.10% 12.60% 2.23% 10.04% NA
Indica I  595 2.20% 1.20% 0.50% 96.13% NA
Indica II  465 31.60% 1.30% 1.51% 65.59% NA
Indica III  913 7.10% 0.90% 1.75% 90.25% NA
Indica Intermediate  786 13.40% 2.40% 1.15% 83.08% NA
Temperate Japonica  767 11.30% 88.00% 0.00% 0.65% NA
Tropical Japonica  504 89.30% 8.10% 0.00% 2.58% NA
Japonica Intermediate  241 43.20% 55.20% 0.00% 1.66% NA
VI/Aromatic  96 15.60% 11.50% 4.17% 68.75% NA
Intermediate  90 33.30% 27.80% 3.33% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002880362 T -> C LOC_Os10g05710.1 missense_variant ; p.Trp634Arg; MODERATE nonsynonymous_codon ; W634R Average:12.962; most accessible tissue: Callus, score: 26.869 unknown unknown TOLERATED 1.00
vg1002880362 T -> DEL LOC_Os10g05710.1 N frameshift_variant Average:12.962; most accessible tissue: Callus, score: 26.869 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002880362 NA 1.05E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 4.20E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 4.13E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 1.96E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 6.79E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 3.13E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 7.22E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 1.49E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 9.89E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 1.63E-14 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 7.75E-10 mr1543 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 1.75E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 3.45E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 5.97E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 7.28E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 3.88E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 9.45E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 9.93E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 2.16E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 1.76E-06 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 6.88E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 5.09E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 1.18E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 4.96E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 3.21E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 1.28E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002880362 NA 3.89E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251