\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002595660:

Variant ID: vg1002595660 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2595660
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.09, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


CATACATAAAAGGAACTGAACATGAAGAGGATCGATGTGGTAAAGAGCTGAACCTTCCCGAACTGATCCATAAGAACATTATCCAACTGTTGGGTTTCTG[C/T]
TGTAAGCTGGATGCTGTAATATTGGTTTATGAATTTGCTAACAAAGGGAGCCTCTACGACATACTCCATGGTACTAGCAATTTTCCTTTCCCACTAGATT

Reverse complement sequence

AATCTAGTGGGAAAGGAAAATTGCTAGTACCATGGAGTATGTCGTAGAGGCTCCCTTTGTTAGCAAATTCATAAACCAATATTACAGCATCCAGCTTACA[G/A]
CAGAAACCCAACAGTTGGATAATGTTCTTATGGATCAGTTCGGGAAGGTTCAGCTCTTTACCACATCGATCCTCTTCATGTTCAGTTCCTTTTATGTATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 29.90% 0.72% 4.55% NA
All Indica  2759 91.90% 8.00% 0.07% 0.00% NA
All Japonica  1512 31.60% 53.00% 1.92% 13.49% NA
Aus  269 0.70% 98.90% 0.00% 0.37% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 86.20% 13.70% 0.11% 0.00% NA
Indica Intermediate  786 88.80% 11.20% 0.00% 0.00% NA
Temperate Japonica  767 41.70% 34.60% 3.13% 20.60% NA
Tropical Japonica  504 8.30% 87.70% 0.60% 3.37% NA
Japonica Intermediate  241 48.10% 39.00% 0.83% 12.03% NA
VI/Aromatic  96 2.10% 88.50% 2.08% 7.29% NA
Intermediate  90 50.00% 45.60% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002595660 C -> T LOC_Os10g05250.1 synonymous_variant ; p.Cys438Cys; LOW synonymous_codon Average:50.47; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg1002595660 C -> DEL LOC_Os10g05250.1 N frameshift_variant Average:50.47; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002595660 NA 1.65E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 8.47E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 5.71E-08 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 1.06E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 2.36E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 7.37E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 1.15E-06 mr1292 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 4.22E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 3.43E-06 3.43E-06 mr1385 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 6.50E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 6.74E-07 mr1603 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 2.86E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 4.76E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 3.04E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 1.76E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 1.28E-19 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 4.57E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 7.80E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 2.10E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 3.65E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002595660 NA 6.22E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251