\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002319935:

Variant ID: vg1002319935 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2319935
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCAAGGGCTGGGGGCGAATAGGTTCCGCCACACCCAGACCCTTCGCCACAATACCAATAAGGTGCGGCGTCAAGGGCTGCGGATGAACAGGTTTCGCCC[G/A,T]
CCCACGCCCTTCGCCATAGTGCTAATAAGGTACGACGTCAAGGGCTGGGGGTGAATAGGTTTTTCCATACCCAAGCCCTTCGCCACAGTACCAATGAGGT

Reverse complement sequence

ACCTCATTGGTACTGTGGCGAAGGGCTTGGGTATGGAAAAACCTATTCACCCCCAGCCCTTGACGTCGTACCTTATTAGCACTATGGCGAAGGGCGTGGG[C/T,A]
GGGCGAAACCTGTTCATCCGCAGCCCTTGACGCCGCACCTTATTGGTATTGTGGCGAAGGGTCTGGGTGTGGCGGAACCTATTCGCCCCCAGCCCTTGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 10.70% 0.08% 1.93% NA
All Indica  2759 95.00% 1.60% 0.07% 3.26% NA
All Japonica  1512 69.90% 30.00% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 82.20% 5.00% 0.17% 12.61% NA
Indica II  465 98.50% 1.10% 0.00% 0.43% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 1.10% 0.13% 1.65% NA
Temperate Japonica  767 59.50% 40.30% 0.26% 0.00% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 49.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002319935 G -> T LOC_Os10g04800.1 downstream_gene_variant ; 2351.0bp to feature; MODIFIER N Average:64.702; most accessible tissue: Minghui63 flag leaf, score: 82.75 N N N N
vg1002319935 G -> T LOC_Os10g04810.1 intron_variant ; MODIFIER N Average:64.702; most accessible tissue: Minghui63 flag leaf, score: 82.75 N N N N
vg1002319935 G -> A LOC_Os10g04800.1 downstream_gene_variant ; 2351.0bp to feature; MODIFIER silent_mutation Average:64.702; most accessible tissue: Minghui63 flag leaf, score: 82.75 N N N N
vg1002319935 G -> A LOC_Os10g04810.1 intron_variant ; MODIFIER silent_mutation Average:64.702; most accessible tissue: Minghui63 flag leaf, score: 82.75 N N N N
vg1002319935 G -> DEL N N silent_mutation Average:64.702; most accessible tissue: Minghui63 flag leaf, score: 82.75 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002319935 4.82E-06 NA mr1928 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002319935 NA 9.22E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002319935 NA 2.23E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251