\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002297086:

Variant ID: vg1002297086 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2297086
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


GGCAAGCCAGCAAATTCATTTGTCACTATCAGTCACACAATTTAACAAATTTCACAAACATCAGAGTTCAAAGCCTGGATCAAGCTGTGATGATAATGAC[G/A]
ACTTCAACGAAACAAATAACTGCATGTCTGTTCTGGGTTTAAAACCCATAAGAAACATGTGTTCAGCTGCGCACATCAGCCTAATTAGTGCTATGACTGA

Reverse complement sequence

TCAGTCATAGCACTAATTAGGCTGATGTGCGCAGCTGAACACATGTTTCTTATGGGTTTTAAACCCAGAACAGACATGCAGTTATTTGTTTCGTTGAAGT[C/T]
GTCATTATCATCACAGCTTGATCCAGGCTTTGAACTCTGATGTTTGTGAAATTTGTTAAATTGTGTGACTGATAGTGACAAATGAATTTGCTGGCTTGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 36.50% 0.02% 0.00% NA
All Indica  2759 86.40% 13.60% 0.00% 0.00% NA
All Japonica  1512 16.50% 83.50% 0.07% 0.00% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 67.20% 32.80% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 89.40% 10.60% 0.00% 0.00% NA
Indica Intermediate  786 90.70% 9.30% 0.00% 0.00% NA
Temperate Japonica  767 8.90% 91.00% 0.13% 0.00% NA
Tropical Japonica  504 24.40% 75.60% 0.00% 0.00% NA
Japonica Intermediate  241 24.10% 75.90% 0.00% 0.00% NA
VI/Aromatic  96 58.30% 41.70% 0.00% 0.00% NA
Intermediate  90 63.30% 36.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002297086 G -> A LOC_Os10g04770.1 upstream_gene_variant ; 4318.0bp to feature; MODIFIER silent_mutation Average:63.557; most accessible tissue: Zhenshan97 root, score: 77.09 N N N N
vg1002297086 G -> A LOC_Os10g04780.1 downstream_gene_variant ; 2352.0bp to feature; MODIFIER silent_mutation Average:63.557; most accessible tissue: Zhenshan97 root, score: 77.09 N N N N
vg1002297086 G -> A LOC_Os10g04770-LOC_Os10g04780 intergenic_region ; MODIFIER silent_mutation Average:63.557; most accessible tissue: Zhenshan97 root, score: 77.09 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002297086 NA 6.39E-07 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002297086 7.14E-06 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002297086 NA 8.04E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002297086 NA 2.14E-07 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002297086 NA 1.82E-06 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002297086 NA 3.88E-10 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002297086 2.95E-07 6.46E-15 mr1709_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251