\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002008736:

Variant ID: vg1002008736 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2008736
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTAAAATTTGAAATATAAATAAAAATAAATCTGAAATTACAAAAAGAAAATAAAATAAGAGTTAAAGCAGGATTATAATTTAAAATTAGATGAAATTC[G/A]
GAATTAAAAATAAGCAATATTGAAAGAAGAATCCATATAAGAACCCAATACGAGATTAATTAAAATTTAGAATAAAAAATAAAATAATATCCAAAATTAG

Reverse complement sequence

CTAATTTTGGATATTATTTTATTTTTTATTCTAAATTTTAATTAATCTCGTATTGGGTTCTTATATGGATTCTTCTTTCAATATTGCTTATTTTTAATTC[C/T]
GAATTTCATCTAATTTTAAATTATAATCCTGCTTTAACTCTTATTTTATTTTCTTTTTGTAATTTCAGATTTATTTTTATTTATATTTCAAATTTTAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.10% 1.60% 1.97% 6.41% NA
All Indica  2759 88.40% 0.10% 2.72% 8.74% NA
All Japonica  1512 94.20% 4.40% 0.73% 0.66% NA
Aus  269 79.90% 0.00% 1.49% 18.59% NA
Indica I  595 86.60% 0.00% 3.03% 10.42% NA
Indica II  465 89.00% 0.20% 1.94% 8.82% NA
Indica III  913 88.80% 0.10% 2.63% 8.43% NA
Indica Intermediate  786 88.90% 0.30% 3.05% 7.76% NA
Temperate Japonica  767 97.10% 1.30% 1.04% 0.52% NA
Tropical Japonica  504 95.60% 3.60% 0.20% 0.60% NA
Japonica Intermediate  241 81.70% 16.20% 0.83% 1.24% NA
VI/Aromatic  96 96.90% 1.00% 2.08% 0.00% NA
Intermediate  90 94.40% 2.20% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002008736 G -> A LOC_Os10g04280.1 upstream_gene_variant ; 2263.0bp to feature; MODIFIER silent_mutation Average:16.362; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1002008736 G -> A LOC_Os10g04270-LOC_Os10g04280 intergenic_region ; MODIFIER silent_mutation Average:16.362; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1002008736 G -> DEL N N silent_mutation Average:16.362; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002008736 NA 2.55E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 NA 9.29E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 NA 2.15E-08 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 NA 6.35E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 NA 8.00E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 NA 3.38E-08 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 6.79E-07 1.39E-09 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 NA 2.06E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 NA 2.68E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 NA 3.47E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 NA 1.86E-07 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 4.68E-07 6.71E-09 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 5.24E-07 3.42E-09 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 NA 4.14E-08 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 4.52E-06 2.84E-08 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 1.67E-06 2.21E-08 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 6.67E-07 2.30E-09 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 4.99E-08 9.21E-11 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 1.24E-06 1.53E-09 mr1242_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 2.47E-06 2.85E-08 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 7.12E-06 6.79E-09 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 2.97E-08 1.45E-11 mr1496_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002008736 3.51E-06 4.23E-08 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251