Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1001832131:

Variant ID: vg1001832131 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1832131
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, G: 0.06, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

ATCATCTCCAAAACGCTCAGCCTGGCCTCAACCACCAATTCCTATATCCCTTCCTTCTCCTGAACCGTTGGGCCAGAGCCAAACAAAACCCCTTCCCCCT[C/G]
CCCTTCCTCCTCCTCCTCCCACTCTCACGCCCCTTCCTCACCTCGCCTGAGCTGACAAACAATAGTAGCAGCTTCCCTACAAACAAAGATGGGGTATATA

Reverse complement sequence

TATATACCCCATCTTTGTTTGTAGGGAAGCTGCTACTATTGTTTGTCAGCTCAGGCGAGGTGAGGAAGGGGCGTGAGAGTGGGAGGAGGAGGAGGAAGGG[G/C]
AGGGGGAAGGGGTTTTGTTTGGCTCTGGCCCAACGGTTCAGGAGAAGGAAGGGATATAGGAATTGGTGGTTGAGGCCAGGCTGAGCGTTTTGGAGATGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.60%	35.30%	0.08%	0.00%	NA
All Indica	2759	40.90%	59.00%	0.11%	0.00%	NA
All Japonica	1512	98.30%	1.70%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	45.70%	53.90%	0.34%	0.00%	NA
Indica II	465	32.00%	68.00%	0.00%	0.00%	NA
Indica III	913	41.60%	58.40%	0.00%	0.00%	NA
Indica Intermediate	786	41.60%	58.30%	0.13%	0.00%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	96.60%	3.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.20%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001832131	C -> G	LOC_Os10g04000.1	upstream_gene_variant ; 1754.0bp to feature; MODIFIER	silent_mutation	Average:74.255; most accessible tissue: Zhenshan97 young leaf, score: 88.878	N	N	N	N
vg1001832131	C -> G	LOC_Os10g04010.1	downstream_gene_variant ; 1073.0bp to feature; MODIFIER	silent_mutation	Average:74.255; most accessible tissue: Zhenshan97 young leaf, score: 88.878	N	N	N	N
vg1001832131	C -> G	LOC_Os10g04000-LOC_Os10g04010	intergenic_region ; MODIFIER	silent_mutation	Average:74.255; most accessible tissue: Zhenshan97 young leaf, score: 88.878	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001832131	4.37E-09	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001832131	2.33E-09	4.13E-13	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001832131	2.56E-07	NA	mr1548	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001832131	6.21E-07	4.43E-09	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001832131	NA	1.68E-06	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001832131	1.48E-06	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001832131	1.31E-07	4.94E-11	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001832131	2.36E-06	NA	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001832131	NA	3.17E-07	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251