\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001637985:

Variant ID: vg1001637985 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1637985
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TATTGCATGGACAATAAATAAAACCCTTATGTCTGTTAGCTTCGGCCACTCTCAAAAAATAATGCACGCCGTCAATAAACTCTTTGGACCGACGGTCAGC[A/G]
TACATCCATTGCCGATCGATCTACATGACATGAAAAAAATCGTACACAAATAATTATTCTTACAATAATGACAGTCATACAATAATTATAAAATAATTAC

Reverse complement sequence

GTAATTATTTTATAATTATTGTATGACTGTCATTATTGTAAGAATAATTATTTGTGTACGATTTTTTTCATGTCATGTAGATCGATCGGCAATGGATGTA[T/C]
GCTGACCGTCGGTCCAAAGAGTTTATTGACGGCGTGCATTATTTTTTGAGAGTGGCCGAAGCTAACAGACATAAGGGTTTTATTTATTGTCCATGCAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.40% 35.20% 0.34% 19.09% NA
All Indica  2759 67.10% 3.70% 0.33% 28.89% NA
All Japonica  1512 5.60% 93.50% 0.33% 0.60% NA
Aus  269 66.20% 2.20% 0.37% 31.23% NA
Indica I  595 58.00% 1.70% 0.00% 40.34% NA
Indica II  465 68.40% 5.20% 0.43% 26.02% NA
Indica III  913 69.80% 2.60% 0.22% 27.38% NA
Indica Intermediate  786 70.10% 5.60% 0.64% 23.66% NA
Temperate Japonica  767 1.80% 97.50% 0.52% 0.13% NA
Tropical Japonica  504 12.70% 85.90% 0.00% 1.39% NA
Japonica Intermediate  241 2.50% 96.70% 0.41% 0.41% NA
VI/Aromatic  96 7.30% 91.70% 0.00% 1.04% NA
Intermediate  90 26.70% 60.00% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001637985 A -> G LOC_Os10g03660.1 upstream_gene_variant ; 2027.0bp to feature; MODIFIER silent_mutation Average:43.358; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1001637985 A -> G LOC_Os10g03669.1 downstream_gene_variant ; 4350.0bp to feature; MODIFIER silent_mutation Average:43.358; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1001637985 A -> G LOC_Os10g03669.2 downstream_gene_variant ; 4432.0bp to feature; MODIFIER silent_mutation Average:43.358; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1001637985 A -> G LOC_Os10g03660-LOC_Os10g03669 intergenic_region ; MODIFIER silent_mutation Average:43.358; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1001637985 A -> DEL N N silent_mutation Average:43.358; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001637985 NA 1.81E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001637985 NA 4.99E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001637985 NA 9.12E-07 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001637985 NA 1.78E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001637985 NA 8.43E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001637985 NA 1.56E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001637985 2.24E-06 NA mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001637985 1.63E-07 1.30E-09 mr1721_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251