Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1001637985:

Variant ID: vg1001637985 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1637985
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TATTGCATGGACAATAAATAAAACCCTTATGTCTGTTAGCTTCGGCCACTCTCAAAAAATAATGCACGCCGTCAATAAACTCTTTGGACCGACGGTCAGC[A/G]
TACATCCATTGCCGATCGATCTACATGACATGAAAAAAATCGTACACAAATAATTATTCTTACAATAATGACAGTCATACAATAATTATAAAATAATTAC

Reverse complement sequence

GTAATTATTTTATAATTATTGTATGACTGTCATTATTGTAAGAATAATTATTTGTGTACGATTTTTTTCATGTCATGTAGATCGATCGGCAATGGATGTA[T/C]
GCTGACCGTCGGTCCAAAGAGTTTATTGACGGCGTGCATTATTTTTTGAGAGTGGCCGAAGCTAACAGACATAAGGGTTTTATTTATTGTCCATGCAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.40%	35.20%	0.34%	19.09%	NA
All Indica	2759	67.10%	3.70%	0.33%	28.89%	NA
All Japonica	1512	5.60%	93.50%	0.33%	0.60%	NA
Aus	269	66.20%	2.20%	0.37%	31.23%	NA
Indica I	595	58.00%	1.70%	0.00%	40.34%	NA
Indica II	465	68.40%	5.20%	0.43%	26.02%	NA
Indica III	913	69.80%	2.60%	0.22%	27.38%	NA
Indica Intermediate	786	70.10%	5.60%	0.64%	23.66%	NA
Temperate Japonica	767	1.80%	97.50%	0.52%	0.13%	NA
Tropical Japonica	504	12.70%	85.90%	0.00%	1.39%	NA
Japonica Intermediate	241	2.50%	96.70%	0.41%	0.41%	NA
VI/Aromatic	96	7.30%	91.70%	0.00%	1.04%	NA
Intermediate	90	26.70%	60.00%	1.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001637985	A -> G	LOC_Os10g03660.1	upstream_gene_variant ; 2027.0bp to feature; MODIFIER	silent_mutation	Average:43.358; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1001637985	A -> G	LOC_Os10g03669.1	downstream_gene_variant ; 4350.0bp to feature; MODIFIER	silent_mutation	Average:43.358; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1001637985	A -> G	LOC_Os10g03669.2	downstream_gene_variant ; 4432.0bp to feature; MODIFIER	silent_mutation	Average:43.358; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1001637985	A -> G	LOC_Os10g03660-LOC_Os10g03669	intergenic_region ; MODIFIER	silent_mutation	Average:43.358; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1001637985	A -> DEL	N	N	silent_mutation	Average:43.358; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001637985	NA	1.81E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001637985	NA	4.99E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001637985	NA	9.12E-07	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001637985	NA	1.78E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001637985	NA	8.43E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001637985	NA	1.56E-08	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001637985	2.24E-06	NA	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001637985	1.63E-07	1.30E-09	mr1721_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251