Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1001528261:

Variant ID: vg1001528261 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1528261
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.21, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CCTAGATCATCTGATTCTATTCGTATTACATCACACGATTTCTGGAACATGTTAGCATAATTTTAAGTCAGTCTCCACACATGCTCGTACGTAAGAATTA[G/A]
TTTTACTTTCTAAAATAACGTGCCAGCTAAAATAAAGGATGATCAAAGTTGCTGAATCCGTCCGTCATCAACTCCTGCCCGACTTGAGATAAAGCTGGAC

Reverse complement sequence

GTCCAGCTTTATCTCAAGTCGGGCAGGAGTTGATGACGGACGGATTCAGCAACTTTGATCATCCTTTATTTTAGCTGGCACGTTATTTTAGAAAGTAAAA[C/T]
TAATTCTTACGTACGAGCATGTGTGGAGACTGACTTAAAATTATGCTAACATGTTCCAGAAATCGTGTGATGTAATACGAATAGAATCAGATGATCTAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.80%	22.10%	0.17%	0.89%	NA
All Indica	2759	62.10%	36.10%	0.25%	1.52%	NA
All Japonica	1512	98.80%	1.20%	0.00%	0.00%	NA
Aus	269	95.90%	3.70%	0.37%	0.00%	NA
Indica I	595	58.50%	40.70%	0.67%	0.17%	NA
Indica II	465	69.00%	29.00%	0.00%	1.94%	NA
Indica III	913	55.60%	41.60%	0.00%	2.74%	NA
Indica Intermediate	786	68.30%	30.40%	0.38%	0.89%	NA
Temperate Japonica	767	98.80%	1.20%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001528261	G -> A	LOC_Os10g03530.1	upstream_gene_variant ; 1967.0bp to feature; MODIFIER	silent_mutation	Average:38.114; most accessible tissue: Callus, score: 60.808	N	N	N	N
vg1001528261	G -> A	LOC_Os10g03540.1	upstream_gene_variant ; 2298.0bp to feature; MODIFIER	silent_mutation	Average:38.114; most accessible tissue: Callus, score: 60.808	N	N	N	N
vg1001528261	G -> A	LOC_Os10g03550.1	upstream_gene_variant ; 4533.0bp to feature; MODIFIER	silent_mutation	Average:38.114; most accessible tissue: Callus, score: 60.808	N	N	N	N
vg1001528261	G -> A	LOC_Os10g03550.2	upstream_gene_variant ; 4533.0bp to feature; MODIFIER	silent_mutation	Average:38.114; most accessible tissue: Callus, score: 60.808	N	N	N	N
vg1001528261	G -> A	LOC_Os10g03550.3	upstream_gene_variant ; 4533.0bp to feature; MODIFIER	silent_mutation	Average:38.114; most accessible tissue: Callus, score: 60.808	N	N	N	N
vg1001528261	G -> A	LOC_Os10g03520.1	downstream_gene_variant ; 3824.0bp to feature; MODIFIER	silent_mutation	Average:38.114; most accessible tissue: Callus, score: 60.808	N	N	N	N
vg1001528261	G -> A	LOC_Os10g03530-LOC_Os10g03540	intergenic_region ; MODIFIER	silent_mutation	Average:38.114; most accessible tissue: Callus, score: 60.808	N	N	N	N
vg1001528261	G -> DEL	N	N	silent_mutation	Average:38.114; most accessible tissue: Callus, score: 60.808	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001528261	NA	9.13E-07	mr1158	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001528261	NA	9.24E-07	mr1168_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001528261	NA	2.24E-06	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251