\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001528261:

Variant ID: vg1001528261 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1528261
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.21, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAGATCATCTGATTCTATTCGTATTACATCACACGATTTCTGGAACATGTTAGCATAATTTTAAGTCAGTCTCCACACATGCTCGTACGTAAGAATTA[G/A]
TTTTACTTTCTAAAATAACGTGCCAGCTAAAATAAAGGATGATCAAAGTTGCTGAATCCGTCCGTCATCAACTCCTGCCCGACTTGAGATAAAGCTGGAC

Reverse complement sequence

GTCCAGCTTTATCTCAAGTCGGGCAGGAGTTGATGACGGACGGATTCAGCAACTTTGATCATCCTTTATTTTAGCTGGCACGTTATTTTAGAAAGTAAAA[C/T]
TAATTCTTACGTACGAGCATGTGTGGAGACTGACTTAAAATTATGCTAACATGTTCCAGAAATCGTGTGATGTAATACGAATAGAATCAGATGATCTAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.80% 22.10% 0.17% 0.89% NA
All Indica  2759 62.10% 36.10% 0.25% 1.52% NA
All Japonica  1512 98.80% 1.20% 0.00% 0.00% NA
Aus  269 95.90% 3.70% 0.37% 0.00% NA
Indica I  595 58.50% 40.70% 0.67% 0.17% NA
Indica II  465 69.00% 29.00% 0.00% 1.94% NA
Indica III  913 55.60% 41.60% 0.00% 2.74% NA
Indica Intermediate  786 68.30% 30.40% 0.38% 0.89% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001528261 G -> A LOC_Os10g03530.1 upstream_gene_variant ; 1967.0bp to feature; MODIFIER silent_mutation Average:38.114; most accessible tissue: Callus, score: 60.808 N N N N
vg1001528261 G -> A LOC_Os10g03540.1 upstream_gene_variant ; 2298.0bp to feature; MODIFIER silent_mutation Average:38.114; most accessible tissue: Callus, score: 60.808 N N N N
vg1001528261 G -> A LOC_Os10g03550.1 upstream_gene_variant ; 4533.0bp to feature; MODIFIER silent_mutation Average:38.114; most accessible tissue: Callus, score: 60.808 N N N N
vg1001528261 G -> A LOC_Os10g03550.2 upstream_gene_variant ; 4533.0bp to feature; MODIFIER silent_mutation Average:38.114; most accessible tissue: Callus, score: 60.808 N N N N
vg1001528261 G -> A LOC_Os10g03550.3 upstream_gene_variant ; 4533.0bp to feature; MODIFIER silent_mutation Average:38.114; most accessible tissue: Callus, score: 60.808 N N N N
vg1001528261 G -> A LOC_Os10g03520.1 downstream_gene_variant ; 3824.0bp to feature; MODIFIER silent_mutation Average:38.114; most accessible tissue: Callus, score: 60.808 N N N N
vg1001528261 G -> A LOC_Os10g03530-LOC_Os10g03540 intergenic_region ; MODIFIER silent_mutation Average:38.114; most accessible tissue: Callus, score: 60.808 N N N N
vg1001528261 G -> DEL N N silent_mutation Average:38.114; most accessible tissue: Callus, score: 60.808 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001528261 NA 9.13E-07 mr1158 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001528261 NA 9.24E-07 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001528261 NA 2.24E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251