\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001498051:

Variant ID: vg1001498051 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1498051
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:


CCACTAAGTTCCAATGAGCTATATCTTGTAGCGGTAGCGGTAGAGGTCCGTTACCACTATAGTAGGTGTTATTGTTGGCGCTACGAACACTATTTATTAG[T/C]
TTGATTAAAGGTATACACATGAATTACTGTTGAAACTGGATCGATAAATTATTTGAAAAGATCGGTTGTTTCATTTGTTTCAGCAATTAAATATGCTTAA

Reverse complement sequence

TTAAGCATATTTAATTGCTGAAACAAATGAAACAACCGATCTTTTCAAATAATTTATCGATCCAGTTTCAACAGTAATTCATGTGTATACCTTTAATCAA[A/G]
CTAATAAATAGTGTTCGTAGCGCCAACAATAACACCTACTATAGTGGTAACGGACCTCTACCGCTACCGCTACAAGATATAGCTCATTGGAACTTAGTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.90% 24.60% 1.25% 27.19% NA
All Indica  2759 53.90% 8.20% 1.52% 36.39% NA
All Japonica  1512 40.30% 54.00% 0.73% 4.96% NA
Aus  269 32.00% 0.70% 1.86% 65.43% NA
Indica I  595 58.30% 1.70% 1.51% 38.49% NA
Indica II  465 64.70% 6.00% 1.72% 27.53% NA
Indica III  913 45.30% 11.80% 1.31% 41.51% NA
Indica Intermediate  786 54.10% 10.20% 1.65% 34.10% NA
Temperate Japonica  767 72.90% 25.70% 0.39% 1.04% NA
Tropical Japonica  504 4.00% 82.70% 1.19% 12.10% NA
Japonica Intermediate  241 12.90% 83.80% 0.83% 2.49% NA
VI/Aromatic  96 4.20% 84.40% 0.00% 11.46% NA
Intermediate  90 34.40% 43.30% 1.11% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001498051 T -> C LOC_Os10g03480.1 downstream_gene_variant ; 97.0bp to feature; MODIFIER silent_mutation Average:62.681; most accessible tissue: Callus, score: 81.194 N N N N
vg1001498051 T -> C LOC_Os10g03490.1 downstream_gene_variant ; 3228.0bp to feature; MODIFIER silent_mutation Average:62.681; most accessible tissue: Callus, score: 81.194 N N N N
vg1001498051 T -> C LOC_Os10g03470-LOC_Os10g03480 intergenic_region ; MODIFIER silent_mutation Average:62.681; most accessible tissue: Callus, score: 81.194 N N N N
vg1001498051 T -> DEL N N silent_mutation Average:62.681; most accessible tissue: Callus, score: 81.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001498051 NA 4.29E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 8.27E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 2.06E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 3.16E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 1.21E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 3.13E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 4.35E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 2.14E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 4.28E-13 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 1.08E-09 4.08E-08 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 5.90E-12 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 6.64E-10 7.75E-09 mr1548 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 3.84E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 1.98E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 5.05E-07 6.30E-06 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 1.30E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 1.07E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 8.52E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 5.16E-12 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 3.94E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 1.01E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 6.45E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 2.56E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 1.64E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 2.37E-12 6.73E-11 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 9.96E-07 1.36E-14 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 6.73E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 3.31E-12 1.74E-08 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001498051 NA 1.60E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251