\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001458161:

Variant ID: vg1001458161 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1458161
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCCATCCCTCGCGCACTCTGCCACCAGCCACCGCTTCTCCAGGTGGGTCCTTCCAGCCTGTTCGCATCCTCGGTGTGGAAACCGTCATCTTTTGTAACC[A/G]
GCGATTAGCATCATTAGGGCCTCCTTCCAATCTTCTTTATGTATGGCGATACGCATGACAGGGTTTGGTACTAATCCTGTACTACGATGTGTGAAAACAA

Reverse complement sequence

TTGTTTTCACACATCGTAGTACAGGATTAGTACCAAACCCTGTCATGCGTATCGCCATACATAAAGAAGATTGGAAGGAGGCCCTAATGATGCTAATCGC[T/C]
GGTTACAAAAGATGACGGTTTCCACACCGAGGATGCGAACAGGCTGGAAGGACCCACCTGGAGAAGCGGTGGCTGGTGGCAGAGTGCGCGAGGGATGGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 12.70% 0.32% 27.00% NA
All Indica  2759 87.00% 0.40% 0.18% 12.43% NA
All Japonica  1512 7.40% 38.10% 0.53% 53.97% NA
Aus  269 97.00% 0.00% 0.00% 2.97% NA
Indica I  595 86.10% 0.70% 0.34% 12.94% NA
Indica II  465 92.90% 0.60% 0.00% 6.45% NA
Indica III  913 84.70% 0.10% 0.22% 15.01% NA
Indica Intermediate  786 86.80% 0.50% 0.13% 12.60% NA
Temperate Japonica  767 1.00% 70.50% 0.91% 27.51% NA
Tropical Japonica  504 17.70% 1.40% 0.00% 80.95% NA
Japonica Intermediate  241 6.20% 11.60% 0.41% 81.74% NA
VI/Aromatic  96 17.70% 3.10% 0.00% 79.17% NA
Intermediate  90 48.90% 12.20% 2.22% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001458161 A -> G LOC_Os10g03410.1 downstream_gene_variant ; 4766.0bp to feature; MODIFIER silent_mutation Average:76.198; most accessible tissue: Callus, score: 91.927 N N N N
vg1001458161 A -> G LOC_Os10g03420.1 downstream_gene_variant ; 1059.0bp to feature; MODIFIER silent_mutation Average:76.198; most accessible tissue: Callus, score: 91.927 N N N N
vg1001458161 A -> G LOC_Os10g03420-LOC_Os10g03430 intergenic_region ; MODIFIER silent_mutation Average:76.198; most accessible tissue: Callus, score: 91.927 N N N N
vg1001458161 A -> DEL N N silent_mutation Average:76.198; most accessible tissue: Callus, score: 91.927 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001458161 NA 7.06E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 3.74E-07 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 8.80E-07 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 6.49E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 1.04E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 7.30E-22 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 1.18E-06 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 1.51E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 2.16E-07 2.98E-43 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 1.13E-14 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 8.28E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 4.83E-06 3.06E-24 mr1548 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 1.01E-09 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 5.44E-10 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 8.91E-23 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 4.58E-09 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 5.57E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 8.73E-24 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 4.25E-12 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 1.24E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 5.78E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 1.20E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 2.92E-07 2.18E-39 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 7.18E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 6.56E-13 4.87E-54 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 6.45E-10 1.02E-18 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 9.20E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 5.61E-19 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161 NA 6.22E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251