Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001458161:

Variant ID: vg1001458161 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1458161
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCCATCCCTCGCGCACTCTGCCACCAGCCACCGCTTCTCCAGGTGGGTCCTTCCAGCCTGTTCGCATCCTCGGTGTGGAAACCGTCATCTTTTGTAACC[A/G]
GCGATTAGCATCATTAGGGCCTCCTTCCAATCTTCTTTATGTATGGCGATACGCATGACAGGGTTTGGTACTAATCCTGTACTACGATGTGTGAAAACAA

Reverse complement sequence

TTGTTTTCACACATCGTAGTACAGGATTAGTACCAAACCCTGTCATGCGTATCGCCATACATAAAGAAGATTGGAAGGAGGCCCTAATGATGCTAATCGC[T/C]
GGTTACAAAAGATGACGGTTTCCACACCGAGGATGCGAACAGGCTGGAAGGACCCACCTGGAGAAGCGGTGGCTGGTGGCAGAGTGCGCGAGGGATGGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.90%	12.70%	0.32%	27.00%	NA
All Indica	2759	87.00%	0.40%	0.18%	12.43%	NA
All Japonica	1512	7.40%	38.10%	0.53%	53.97%	NA
Aus	269	97.00%	0.00%	0.00%	2.97%	NA
Indica I	595	86.10%	0.70%	0.34%	12.94%	NA
Indica II	465	92.90%	0.60%	0.00%	6.45%	NA
Indica III	913	84.70%	0.10%	0.22%	15.01%	NA
Indica Intermediate	786	86.80%	0.50%	0.13%	12.60%	NA
Temperate Japonica	767	1.00%	70.50%	0.91%	27.51%	NA
Tropical Japonica	504	17.70%	1.40%	0.00%	80.95%	NA
Japonica Intermediate	241	6.20%	11.60%	0.41%	81.74%	NA
VI/Aromatic	96	17.70%	3.10%	0.00%	79.17%	NA
Intermediate	90	48.90%	12.20%	2.22%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001458161	A -> G	LOC_Os10g03410.1	downstream_gene_variant ; 4766.0bp to feature; MODIFIER	silent_mutation	Average:76.198; most accessible tissue: Callus, score: 91.927	N	N	N	N
vg1001458161	A -> G	LOC_Os10g03420.1	downstream_gene_variant ; 1059.0bp to feature; MODIFIER	silent_mutation	Average:76.198; most accessible tissue: Callus, score: 91.927	N	N	N	N
vg1001458161	A -> G	LOC_Os10g03420-LOC_Os10g03430	intergenic_region ; MODIFIER	silent_mutation	Average:76.198; most accessible tissue: Callus, score: 91.927	N	N	N	N
vg1001458161	A -> DEL	N	N	silent_mutation	Average:76.198; most accessible tissue: Callus, score: 91.927	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001458161	NA	7.06E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	3.74E-07	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	8.80E-07	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	6.49E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	1.04E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	7.30E-22	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	1.18E-06	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	1.51E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	2.16E-07	2.98E-43	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	1.13E-14	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	8.28E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	4.83E-06	3.06E-24	mr1548	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	1.01E-09	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	5.44E-10	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	8.91E-23	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	4.58E-09	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	5.57E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	8.73E-24	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	4.25E-12	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	1.24E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	5.78E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	1.20E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	2.92E-07	2.18E-39	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	7.18E-10	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	6.56E-13	4.87E-54	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	6.45E-10	1.02E-18	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	9.20E-06	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	5.61E-19	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001458161	NA	6.22E-07	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251