\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001457645:

Variant ID: vg1001457645 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1457645
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.34, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


AATAGGCTAGAATAGTAATTGCTAGTGAGTGAAGATGTGGCATGTTTGAATGGGTTTTTAAATGGGCTAGAATAGTAATTGCTAGTGGGTGATGACATGG[C/T]
ATGCTTGCATGTTGAGCTTTAGCTTCTAATAATTGTTAGTGGGCACCAACTATATAGAAAGTATATATTCGTAAAAATATGGTTTGCGGTGTACATTTAT

Reverse complement sequence

ATAAATGTACACCGCAAACCATATTTTTACGAATATATACTTTCTATATAGTTGGTGCCCACTAACAATTATTAGAAGCTAAAGCTCAACATGCAAGCAT[G/A]
CCATGTCATCACCCACTAGCAATTACTATTCTAGCCCATTTAAAAACCCATTCAAACATGCCACATCTTCACTCACTAGCAATTACTATTCTAGCCTATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 17.40% 0.44% 26.98% NA
All Indica  2759 80.40% 6.90% 0.29% 12.43% NA
All Japonica  1512 7.30% 38.20% 0.66% 53.84% NA
Aus  269 85.90% 11.20% 0.00% 2.97% NA
Indica I  595 84.20% 2.70% 0.34% 12.77% NA
Indica II  465 90.30% 3.00% 0.00% 6.67% NA
Indica III  913 72.00% 12.60% 0.33% 15.12% NA
Indica Intermediate  786 81.40% 5.70% 0.38% 12.47% NA
Temperate Japonica  767 1.00% 70.70% 1.04% 27.25% NA
Tropical Japonica  504 17.10% 1.60% 0.40% 80.95% NA
Japonica Intermediate  241 6.60% 11.60% 0.00% 81.74% NA
VI/Aromatic  96 10.40% 7.30% 3.12% 79.17% NA
Intermediate  90 43.30% 18.90% 0.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001457645 C -> T LOC_Os10g03410.1 downstream_gene_variant ; 4250.0bp to feature; MODIFIER silent_mutation Average:48.385; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg1001457645 C -> T LOC_Os10g03420.1 downstream_gene_variant ; 543.0bp to feature; MODIFIER silent_mutation Average:48.385; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg1001457645 C -> T LOC_Os10g03420-LOC_Os10g03430 intergenic_region ; MODIFIER silent_mutation Average:48.385; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg1001457645 C -> DEL N N silent_mutation Average:48.385; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001457645 NA 4.39E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 2.84E-11 5.34E-38 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 1.59E-13 1.47E-13 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 NA 1.78E-11 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 1.35E-10 2.63E-26 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 2.72E-14 6.59E-14 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 NA 8.44E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 NA 9.73E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 9.02E-11 7.29E-11 mr1588 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 NA 1.93E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 NA 3.12E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 NA 2.35E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 NA 4.49E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 1.64E-17 5.41E-45 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 1.19E-13 2.11E-11 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 1.13E-06 2.98E-15 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 1.46E-10 NA mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 4.06E-14 7.46E-13 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001457645 NA 9.74E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251