\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001446001:

Variant ID: vg1001446001 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1446001
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:


CTATTGGTGGGCCGTGCCTGGGCCGGAGGTGCAGCCCATGGGCCGGCATAGCCCGGCACAAAGTGCCGACCGAGCCGTACCGGCCCAATCGCTGGTGGGC[C/T]
ATGCCTAGCTATGCTTGGGCCGGGCGCAGTGGCGGATCTAGAAAATCGATTCGTTGGTGTCATAACGTGTCTATCAGTGTCATAGTATACTAATTACACT

Reverse complement sequence

AGTGTAATTAGTATACTATGACACTGATAGACACGTTATGACACCAACGAATCGATTTTCTAGATCCGCCACTGCGCCCGGCCCAAGCATAGCTAGGCAT[G/A]
GCCCACCAGCGATTGGGCCGGTACGGCTCGGTCGGCACTTTGTGCCGGGCTATGCCGGCCCATGGGCTGCACCTCCGGCCCAGGCACGGCCCACCAATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.80% 12.10% 0.74% 26.34% NA
All Indica  2759 68.00% 19.50% 0.47% 12.11% NA
All Japonica  1512 44.60% 1.70% 1.12% 52.58% NA
Aus  269 97.00% 0.00% 0.00% 2.97% NA
Indica I  595 60.30% 26.10% 0.67% 12.94% NA
Indica II  465 66.50% 26.70% 0.22% 6.67% NA
Indica III  913 72.40% 12.40% 0.55% 14.68% NA
Indica Intermediate  786 69.50% 18.40% 0.38% 11.70% NA
Temperate Japonica  767 71.10% 0.80% 0.91% 27.25% NA
Tropical Japonica  504 17.90% 3.00% 1.19% 77.98% NA
Japonica Intermediate  241 16.20% 2.10% 1.66% 80.08% NA
VI/Aromatic  96 17.70% 3.10% 2.08% 77.08% NA
Intermediate  90 51.10% 7.80% 3.33% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001446001 C -> T LOC_Os10g03390.1 downstream_gene_variant ; 680.0bp to feature; MODIFIER silent_mutation Average:76.829; most accessible tissue: Minghui63 young leaf, score: 89.663 N N N N
vg1001446001 C -> T LOC_Os10g03400.2 downstream_gene_variant ; 1359.0bp to feature; MODIFIER silent_mutation Average:76.829; most accessible tissue: Minghui63 young leaf, score: 89.663 N N N N
vg1001446001 C -> T LOC_Os10g03390-LOC_Os10g03400 intergenic_region ; MODIFIER silent_mutation Average:76.829; most accessible tissue: Minghui63 young leaf, score: 89.663 N N N N
vg1001446001 C -> DEL N N silent_mutation Average:76.829; most accessible tissue: Minghui63 young leaf, score: 89.663 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1001446001 C T 0.0 -0.04 -0.03 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001446001 NA 7.76E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 8.34E-07 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 3.82E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 2.51E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 7.85E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 1.17E-08 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 1.71E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 1.55E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 2.11E-09 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 5.64E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 6.08E-16 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 5.87E-12 1.25E-14 mr1486 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 1.96E-12 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 2.05E-12 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 5.16E-09 2.31E-10 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 3.89E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 2.09E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 9.82E-06 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 6.47E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 9.75E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 3.39E-07 mr1721 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 6.77E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 2.80E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 5.18E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 2.27E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 3.63E-18 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 2.96E-09 9.15E-12 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 2.79E-09 1.28E-16 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 4.86E-06 NA mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 2.15E-08 NA mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 2.36E-10 1.48E-13 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446001 NA 5.55E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251