\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001438740:

Variant ID: vg1001438740 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1438740
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


GCTAGCCAAGCTCATGGAGCTCCCTCCCTCCCCTCCCAATTCCAATTGGCCCTCGCCGCCTCCGCTCACCGAGAGAGGGCAGCGAAGGGGGAGAGGAAAA[A/G]
GAGCAGTGATGACAACTGGGCCCTAATTTGCAAAATGATTACACGACATATAGATCACCCATCCAACACTAGACGATTTGATTTCCTCCAACCAAACAAC

Reverse complement sequence

GTTGTTTGGTTGGAGGAAATCAAATCGTCTAGTGTTGGATGGGTGATCTATATGTCGTGTAATCATTTTGCAAATTAGGGCCCAGTTGTCATCACTGCTC[T/C]
TTTTCCTCTCCCCCTTCGCTGCCCTCTCTCGGTGAGCGGAGGCGGCGAGGGCCAATTGGAATTGGGAGGGGAGGGAGGGAGCTCCATGAGCTTGGCTAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 10.00% 0.04% 0.91% NA
All Indica  2759 85.30% 13.70% 0.04% 0.98% NA
All Japonica  1512 99.70% 0.10% 0.07% 0.13% NA
Aus  269 65.80% 32.00% 0.00% 2.23% NA
Indica I  595 85.50% 14.30% 0.00% 0.17% NA
Indica II  465 95.30% 4.50% 0.00% 0.22% NA
Indica III  913 78.10% 19.50% 0.00% 2.41% NA
Indica Intermediate  786 87.70% 11.80% 0.13% 0.38% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 88.90% 10.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001438740 A -> G LOC_Os10g03370.1 downstream_gene_variant ; 2046.0bp to feature; MODIFIER silent_mutation Average:55.776; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg1001438740 A -> G LOC_Os10g03380.1 intron_variant ; MODIFIER silent_mutation Average:55.776; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg1001438740 A -> DEL N N silent_mutation Average:55.776; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001438740 2.64E-06 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740 8.01E-09 1.07E-06 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740 1.79E-08 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740 1.47E-09 2.35E-08 mr1548 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740 9.97E-07 NA mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740 1.24E-06 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740 4.48E-11 4.15E-07 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740 2.47E-07 NA mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438740 2.60E-12 1.79E-06 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251