\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001394803:

Variant ID: vg1001394803 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1394803
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AATTCATTTGCACTTAATAAAAGCCAGTTTCTGCTGTAGTGGAGCGGAGGCCCGTCGCCAGTAGGCTTGGGCCGGAGCGTGCGGCGTTGTAACCTCACCC[C/T]
GATATAGTGAAAATATTTTGTTGGCTGATGTCTGTGGTTTTTTTTCTCCTGCTTTGGGAGGGTTTTCCACATTAAATCTCGTGTCTTCTGTGATTGATAT

Reverse complement sequence

ATATCAATCACAGAAGACACGAGATTTAATGTGGAAAACCCTCCCAAAGCAGGAGAAAAAAAACCACAGACATCAGCCAACAAAATATTTTCACTATATC[G/A]
GGGTGAGGTTACAACGCCGCACGCTCCGGCCCAAGCCTACTGGCGACGGGCCTCCGCTCCACTACAGCAGAAACTGGCTTTTATTAAGTGCAAATGAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.70% 24.80% 0.04% 1.44% NA
All Indica  2759 67.60% 29.90% 0.07% 2.46% NA
All Japonica  1512 95.00% 5.00% 0.00% 0.00% NA
Aus  269 6.30% 93.70% 0.00% 0.00% NA
Indica I  595 60.30% 38.50% 0.00% 1.18% NA
Indica II  465 71.00% 28.60% 0.00% 0.43% NA
Indica III  913 70.60% 25.10% 0.00% 4.27% NA
Indica Intermediate  786 67.60% 29.60% 0.25% 2.54% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 86.30% 13.70% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001394803 C -> T LOC_Os10g03300.1 upstream_gene_variant ; 1129.0bp to feature; MODIFIER silent_mutation Average:53.46; most accessible tissue: Zhenshan97 young leaf, score: 66.83 N N N N
vg1001394803 C -> T LOC_Os10g03290.1 downstream_gene_variant ; 2974.0bp to feature; MODIFIER silent_mutation Average:53.46; most accessible tissue: Zhenshan97 young leaf, score: 66.83 N N N N
vg1001394803 C -> T LOC_Os10g03290-LOC_Os10g03300 intergenic_region ; MODIFIER silent_mutation Average:53.46; most accessible tissue: Zhenshan97 young leaf, score: 66.83 N N N N
vg1001394803 C -> DEL N N silent_mutation Average:53.46; most accessible tissue: Zhenshan97 young leaf, score: 66.83 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001394803 1.95E-10 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803 3.16E-12 1.44E-14 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803 NA 1.86E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803 8.67E-09 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803 1.20E-09 9.18E-11 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803 9.81E-08 NA mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803 7.92E-07 7.88E-10 mr1721 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803 9.98E-10 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803 3.83E-12 2.88E-15 mr1486_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803 6.26E-11 NA mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803 2.46E-09 8.21E-12 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251