Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1001394803:

Variant ID: vg1001394803 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1394803
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

AATTCATTTGCACTTAATAAAAGCCAGTTTCTGCTGTAGTGGAGCGGAGGCCCGTCGCCAGTAGGCTTGGGCCGGAGCGTGCGGCGTTGTAACCTCACCC[C/T]
GATATAGTGAAAATATTTTGTTGGCTGATGTCTGTGGTTTTTTTTCTCCTGCTTTGGGAGGGTTTTCCACATTAAATCTCGTGTCTTCTGTGATTGATAT

Reverse complement sequence

ATATCAATCACAGAAGACACGAGATTTAATGTGGAAAACCCTCCCAAAGCAGGAGAAAAAAAACCACAGACATCAGCCAACAAAATATTTTCACTATATC[G/A]
GGGTGAGGTTACAACGCCGCACGCTCCGGCCCAAGCCTACTGGCGACGGGCCTCCGCTCCACTACAGCAGAAACTGGCTTTTATTAAGTGCAAATGAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.70%	24.80%	0.04%	1.44%	NA
All Indica	2759	67.60%	29.90%	0.07%	2.46%	NA
All Japonica	1512	95.00%	5.00%	0.00%	0.00%	NA
Aus	269	6.30%	93.70%	0.00%	0.00%	NA
Indica I	595	60.30%	38.50%	0.00%	1.18%	NA
Indica II	465	71.00%	28.60%	0.00%	0.43%	NA
Indica III	913	70.60%	25.10%	0.00%	4.27%	NA
Indica Intermediate	786	67.60%	29.60%	0.25%	2.54%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	86.30%	13.70%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001394803	C -> T	LOC_Os10g03300.1	upstream_gene_variant ; 1129.0bp to feature; MODIFIER	silent_mutation	Average:53.46; most accessible tissue: Zhenshan97 young leaf, score: 66.83	N	N	N	N
vg1001394803	C -> T	LOC_Os10g03290.1	downstream_gene_variant ; 2974.0bp to feature; MODIFIER	silent_mutation	Average:53.46; most accessible tissue: Zhenshan97 young leaf, score: 66.83	N	N	N	N
vg1001394803	C -> T	LOC_Os10g03290-LOC_Os10g03300	intergenic_region ; MODIFIER	silent_mutation	Average:53.46; most accessible tissue: Zhenshan97 young leaf, score: 66.83	N	N	N	N
vg1001394803	C -> DEL	N	N	silent_mutation	Average:53.46; most accessible tissue: Zhenshan97 young leaf, score: 66.83	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001394803	1.95E-10	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803	3.16E-12	1.44E-14	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803	NA	1.86E-06	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803	8.67E-09	NA	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803	1.20E-09	9.18E-11	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803	9.81E-08	NA	mr1721	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803	7.92E-07	7.88E-10	mr1721	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803	9.98E-10	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803	3.83E-12	2.88E-15	mr1486_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803	6.26E-11	NA	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001394803	2.46E-09	8.21E-12	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251