\
| Variant ID: vg1001392877 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1392877 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAACTCCATCCCAAAATACTTGGCGCTTTGAGTTTTTGTTTGTAATGTTTATTATTATTTATTTTGTTTGTGACTTGCTTTATTATCAAAAGTACTTTAA[G/A]
TATGACTTATTATTTTTTATATTTGCACTAATTTTTTAAATAAAATGGATGGTCAAATATTGCAACCAAAAAGTCAAAATGACAACTAATTTGGGACGGA
TCCGTCCCAAATTAGTTGTCATTTTGACTTTTTGGTTGCAATATTTGACCATCCATTTTATTTAAAAAATTAGTGCAAATATAAAAAATAATAAGTCATA[C/T]
TTAAAGTACTTTTGATAATAAAGCAAGTCACAAACAAAATAAATAATAATAAACATTACAAACAAAAACTCAAAGCGCCAAGTATTTTGGGATGGAGTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.90% | 12.70% | 0.06% | 1.35% | NA |
| All Indica | 2759 | 96.20% | 1.40% | 0.07% | 2.32% | NA |
| All Japonica | 1512 | 69.90% | 30.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.30% | 0.17% | 0.84% | NA |
| Indica II | 465 | 97.00% | 2.80% | 0.00% | 0.22% | NA |
| Indica III | 913 | 95.50% | 0.10% | 0.11% | 4.27% | NA |
| Indica Intermediate | 786 | 94.80% | 2.80% | 0.00% | 2.42% | NA |
| Temperate Japonica | 767 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.40% | 21.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.00% | 66.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001392877 | G -> A | LOC_Os10g03300.1 | upstream_gene_variant ; 3055.0bp to feature; MODIFIER | silent_mutation | Average:37.705; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg1001392877 | G -> A | LOC_Os10g03280.1 | downstream_gene_variant ; 3691.0bp to feature; MODIFIER | silent_mutation | Average:37.705; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg1001392877 | G -> A | LOC_Os10g03290.1 | downstream_gene_variant ; 1048.0bp to feature; MODIFIER | silent_mutation | Average:37.705; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg1001392877 | G -> A | LOC_Os10g03290-LOC_Os10g03300 | intergenic_region ; MODIFIER | silent_mutation | Average:37.705; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg1001392877 | G -> DEL | N | N | silent_mutation | Average:37.705; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001392877 | 1.21E-06 | NA | mr1217 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001392877 | NA | 1.28E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001392877 | NA | 5.58E-06 | mr1303 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001392877 | NA | 2.07E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001392877 | 2.35E-06 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001392877 | NA | 1.86E-09 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001392877 | NA | 6.06E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001392877 | NA | 5.64E-10 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001392877 | NA | 3.51E-06 | mr1820 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001392877 | 1.50E-07 | NA | mr1845 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001392877 | 4.85E-09 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001392877 | 4.59E-08 | NA | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |