\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001392877:

Variant ID: vg1001392877 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1392877
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAACTCCATCCCAAAATACTTGGCGCTTTGAGTTTTTGTTTGTAATGTTTATTATTATTTATTTTGTTTGTGACTTGCTTTATTATCAAAAGTACTTTAA[G/A]
TATGACTTATTATTTTTTATATTTGCACTAATTTTTTAAATAAAATGGATGGTCAAATATTGCAACCAAAAAGTCAAAATGACAACTAATTTGGGACGGA

Reverse complement sequence

TCCGTCCCAAATTAGTTGTCATTTTGACTTTTTGGTTGCAATATTTGACCATCCATTTTATTTAAAAAATTAGTGCAAATATAAAAAATAATAAGTCATA[C/T]
TTAAAGTACTTTTGATAATAAAGCAAGTCACAAACAAAATAAATAATAATAAACATTACAAACAAAAACTCAAAGCGCCAAGTATTTTGGGATGGAGTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 12.70% 0.06% 1.35% NA
All Indica  2759 96.20% 1.40% 0.07% 2.32% NA
All Japonica  1512 69.90% 30.10% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 98.70% 0.30% 0.17% 0.84% NA
Indica II  465 97.00% 2.80% 0.00% 0.22% NA
Indica III  913 95.50% 0.10% 0.11% 4.27% NA
Indica Intermediate  786 94.80% 2.80% 0.00% 2.42% NA
Temperate Japonica  767 75.60% 24.40% 0.00% 0.00% NA
Tropical Japonica  504 78.40% 21.60% 0.00% 0.00% NA
Japonica Intermediate  241 34.00% 66.00% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001392877 G -> A LOC_Os10g03300.1 upstream_gene_variant ; 3055.0bp to feature; MODIFIER silent_mutation Average:37.705; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg1001392877 G -> A LOC_Os10g03280.1 downstream_gene_variant ; 3691.0bp to feature; MODIFIER silent_mutation Average:37.705; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg1001392877 G -> A LOC_Os10g03290.1 downstream_gene_variant ; 1048.0bp to feature; MODIFIER silent_mutation Average:37.705; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg1001392877 G -> A LOC_Os10g03290-LOC_Os10g03300 intergenic_region ; MODIFIER silent_mutation Average:37.705; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg1001392877 G -> DEL N N silent_mutation Average:37.705; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001392877 1.21E-06 NA mr1217 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392877 NA 1.28E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392877 NA 5.58E-06 mr1303 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392877 NA 2.07E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392877 2.35E-06 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392877 NA 1.86E-09 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392877 NA 6.06E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392877 NA 5.64E-10 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392877 NA 3.51E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392877 1.50E-07 NA mr1845 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392877 4.85E-09 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392877 4.59E-08 NA mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251