\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001392057:

Variant ID: vg1001392057 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1392057
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGACGGCGTGTTCCAGCCGGCGAGCCCGAGAAAGAGAGATTGACAAGTGGGCCTGTGGGCAAACTTGTCTTTAACTAAAGTTTCTCTCTCTGTTTCCA[T/C]
TGAAAATAATAAAATAATATGGCCGGTGTCCGCCAGCTAATTACCACATTTTTCGAGTGTCCACGAGCAAACACACGATCTTCGGGTGTCCCACAACAAA

Reverse complement sequence

TTTGTTGTGGGACACCCGAAGATCGTGTGTTTGCTCGTGGACACTCGAAAAATGTGGTAATTAGCTGGCGGACACCGGCCATATTATTTTATTATTTTCA[A/G]
TGGAAACAGAGAGAGAAACTTTAGTTAAAGACAAGTTTGCCCACAGGCCCACTTGTCAATCTCTCTTTCTCGGGCTCGCCGGCTGGAACACGCCGTCCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 42.50% 0.89% 2.22% NA
All Indica  2759 46.00% 49.50% 1.09% 3.44% NA
All Japonica  1512 59.50% 40.10% 0.40% 0.07% NA
Aus  269 95.90% 2.20% 1.86% 0.00% NA
Indica I  595 39.30% 59.20% 0.67% 0.84% NA
Indica II  465 61.70% 36.80% 0.22% 1.29% NA
Indica III  913 43.40% 48.30% 1.75% 6.57% NA
Indica Intermediate  786 44.70% 51.10% 1.15% 3.05% NA
Temperate Japonica  767 28.00% 71.40% 0.52% 0.00% NA
Tropical Japonica  504 95.00% 4.80% 0.20% 0.00% NA
Japonica Intermediate  241 85.10% 14.10% 0.41% 0.41% NA
VI/Aromatic  96 89.60% 3.10% 0.00% 7.29% NA
Intermediate  90 64.40% 32.20% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001392057 T -> C LOC_Os10g03300.1 upstream_gene_variant ; 3875.0bp to feature; MODIFIER silent_mutation Average:61.671; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg1001392057 T -> C LOC_Os10g03280.1 downstream_gene_variant ; 2871.0bp to feature; MODIFIER silent_mutation Average:61.671; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg1001392057 T -> C LOC_Os10g03290.1 downstream_gene_variant ; 228.0bp to feature; MODIFIER silent_mutation Average:61.671; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg1001392057 T -> C LOC_Os10g03290-LOC_Os10g03300 intergenic_region ; MODIFIER silent_mutation Average:61.671; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg1001392057 T -> DEL N N silent_mutation Average:61.671; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001392057 NA 8.40E-07 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 4.94E-06 NA mr1054 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 5.74E-06 5.74E-06 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 NA 2.56E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 NA 1.37E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 8.61E-06 NA mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 4.15E-06 4.15E-06 mr1287 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 NA 5.46E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 NA 1.84E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 NA 4.83E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 9.60E-13 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 8.00E-09 8.26E-09 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 NA 3.46E-13 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 2.17E-10 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 8.43E-07 7.19E-07 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 NA 1.41E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 NA 3.71E-11 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 NA 1.15E-09 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 NA 6.39E-09 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 NA 1.94E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 NA 3.07E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 NA 1.94E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 1.80E-15 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 3.42E-08 3.69E-06 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 8.43E-09 4.29E-17 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 1.18E-06 NA mr1721_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 3.49E-06 3.59E-09 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001392057 NA 4.98E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251