\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001385309:

Variant ID: vg1001385309 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1385309
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCAGCTATGTGCTTCTATTCCCTACTTTCTAGGTATGAAAAAAGGTGGCAAAATTTGCTACAGGACACCGAAAAATTACGGTCTTTGCTATGAGACACC[C/T]
GAAGATCGTGTGTTTGCTCGTGGACACTATAAAAAAGTGGTAATTAGCTAATGGACACTTCTCACATTATTTTATTATTTCTAGTCAAAATGGAGAGAGA

Reverse complement sequence

TCTCTCTCCATTTTGACTAGAAATAATAAAATAATGTGAGAAGTGTCCATTAGCTAATTACCACTTTTTTATAGTGTCCACGAGCAAACACACGATCTTC[G/A]
GGTGTCTCATAGCAAAGACCGTAATTTTTCGGTGTCCTGTAGCAAATTTTGCCACCTTTTTTCATACCTAGAAAGTAGGGAATAGAAGCACATAGCTGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.90% 12.60% 0.28% 2.18% NA
All Indica  2759 95.10% 1.30% 0.18% 3.41% NA
All Japonica  1512 69.60% 30.20% 0.07% 0.07% NA
Aus  269 97.40% 0.00% 2.60% 0.00% NA
Indica I  595 98.30% 0.30% 0.00% 1.34% NA
Indica II  465 96.60% 2.80% 0.00% 0.65% NA
Indica III  913 93.00% 0.20% 0.55% 6.24% NA
Indica Intermediate  786 94.10% 2.50% 0.00% 3.31% NA
Temperate Japonica  767 75.20% 24.80% 0.00% 0.00% NA
Tropical Japonica  504 78.20% 21.80% 0.00% 0.00% NA
Japonica Intermediate  241 34.00% 65.10% 0.41% 0.41% NA
VI/Aromatic  96 8.30% 84.40% 0.00% 7.29% NA
Intermediate  90 74.40% 24.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001385309 C -> T LOC_Os10g03280.1 upstream_gene_variant ; 3496.0bp to feature; MODIFIER silent_mutation Average:55.285; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg1001385309 C -> T LOC_Os10g03260.1 downstream_gene_variant ; 2794.0bp to feature; MODIFIER silent_mutation Average:55.285; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg1001385309 C -> T LOC_Os10g03270.1 intron_variant ; MODIFIER silent_mutation Average:55.285; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg1001385309 C -> DEL N N silent_mutation Average:55.285; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001385309 2.20E-06 NA mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385309 NA 8.91E-06 mr1303 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385309 8.32E-06 NA mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385309 4.87E-06 7.87E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385309 NA 1.16E-08 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385309 4.09E-06 2.37E-10 mr1514 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385309 NA 4.46E-10 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385309 NA 3.90E-06 mr1685 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385309 NA 3.09E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385309 2.06E-07 NA mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385309 NA 3.38E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385309 1.71E-08 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385309 3.10E-07 NA mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251