\
| Variant ID: vg1001385309 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1385309 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGCAGCTATGTGCTTCTATTCCCTACTTTCTAGGTATGAAAAAAGGTGGCAAAATTTGCTACAGGACACCGAAAAATTACGGTCTTTGCTATGAGACACC[C/T]
GAAGATCGTGTGTTTGCTCGTGGACACTATAAAAAAGTGGTAATTAGCTAATGGACACTTCTCACATTATTTTATTATTTCTAGTCAAAATGGAGAGAGA
TCTCTCTCCATTTTGACTAGAAATAATAAAATAATGTGAGAAGTGTCCATTAGCTAATTACCACTTTTTTATAGTGTCCACGAGCAAACACACGATCTTC[G/A]
GGTGTCTCATAGCAAAGACCGTAATTTTTCGGTGTCCTGTAGCAAATTTTGCCACCTTTTTTCATACCTAGAAAGTAGGGAATAGAAGCACATAGCTGCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.90% | 12.60% | 0.28% | 2.18% | NA |
| All Indica | 2759 | 95.10% | 1.30% | 0.18% | 3.41% | NA |
| All Japonica | 1512 | 69.60% | 30.20% | 0.07% | 0.07% | NA |
| Aus | 269 | 97.40% | 0.00% | 2.60% | 0.00% | NA |
| Indica I | 595 | 98.30% | 0.30% | 0.00% | 1.34% | NA |
| Indica II | 465 | 96.60% | 2.80% | 0.00% | 0.65% | NA |
| Indica III | 913 | 93.00% | 0.20% | 0.55% | 6.24% | NA |
| Indica Intermediate | 786 | 94.10% | 2.50% | 0.00% | 3.31% | NA |
| Temperate Japonica | 767 | 75.20% | 24.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.20% | 21.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.00% | 65.10% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 8.30% | 84.40% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 74.40% | 24.40% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001385309 | C -> T | LOC_Os10g03280.1 | upstream_gene_variant ; 3496.0bp to feature; MODIFIER | silent_mutation | Average:55.285; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg1001385309 | C -> T | LOC_Os10g03260.1 | downstream_gene_variant ; 2794.0bp to feature; MODIFIER | silent_mutation | Average:55.285; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg1001385309 | C -> T | LOC_Os10g03270.1 | intron_variant ; MODIFIER | silent_mutation | Average:55.285; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg1001385309 | C -> DEL | N | N | silent_mutation | Average:55.285; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001385309 | 2.20E-06 | NA | mr1217 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385309 | NA | 8.91E-06 | mr1303 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385309 | 8.32E-06 | NA | mr1304 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385309 | 4.87E-06 | 7.87E-07 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385309 | NA | 1.16E-08 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385309 | 4.09E-06 | 2.37E-10 | mr1514 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385309 | NA | 4.46E-10 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385309 | NA | 3.90E-06 | mr1685 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385309 | NA | 3.09E-06 | mr1820 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385309 | 2.06E-07 | NA | mr1845 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385309 | NA | 3.38E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385309 | 1.71E-08 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385309 | 3.10E-07 | NA | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |