\
| Variant ID: vg1001367351 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1367351 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 119. )
GCGATTTTGCTAGATATCAGTACCACAGTGTTTTTTTTCTCTTTCTTTTTAGGCCTTGTTTAGTTTCCAAAACAAAAACTTTTCACCCATCACATCGAAT[G/A]
TTTGGACACATGCATAGAGTATTAATTAAGGAGGAAAAAAAACATTTACATAGTTTGCGTGTAAATTGCGAGATGAATCTTTTAAACCTAATTGCGTCAT
ATGACGCAATTAGGTTTAAAAGATTCATCTCGCAATTTACACGCAAACTATGTAAATGTTTTTTTTCCTCCTTAATTAATACTCTATGCATGTGTCCAAA[C/T]
ATTCGATGTGATGGGTGAAAAGTTTTTGTTTTGGAAACTAAACAAGGCCTAAAAAGAAAGAGAAAAAAAACACTGTGGTACTGATATCTAGCAAAATCGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.30% | 22.00% | 0.59% | 3.07% | NA |
| All Indica | 2759 | 64.90% | 29.30% | 0.87% | 4.97% | NA |
| All Japonica | 1512 | 94.90% | 4.80% | 0.13% | 0.13% | NA |
| Aus | 269 | 46.10% | 53.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 62.40% | 37.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 68.20% | 29.00% | 0.43% | 2.37% | NA |
| Indica III | 913 | 64.50% | 23.50% | 1.31% | 10.62% | NA |
| Indica Intermediate | 786 | 65.30% | 30.00% | 1.02% | 3.69% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 86.10% | 13.70% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.20% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 14.40% | 2.22% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001367351 | G -> A | LOC_Os10g03250.1 | upstream_gene_variant ; 4936.0bp to feature; MODIFIER | silent_mutation | Average:66.671; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg1001367351 | G -> A | LOC_Os10g03240.1 | intron_variant ; MODIFIER | silent_mutation | Average:66.671; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg1001367351 | G -> DEL | N | N | silent_mutation | Average:66.671; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001367351 | 9.69E-06 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001367351 | 6.99E-09 | 2.33E-12 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001367351 | 1.09E-07 | 1.92E-09 | mr1548 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001367351 | NA | 4.77E-06 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001367351 | NA | 1.94E-07 | mr1721 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001367351 | 9.55E-07 | 2.61E-10 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001367351 | 3.10E-09 | NA | mr1721_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001367351 | 3.94E-09 | 1.71E-11 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |