\
| Variant ID: vg1001366206 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1366206 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 103. )
TGTATATATGCCTCTGTCAGTTTAGTTGTGTCCTTCATATTTCGTTGTGATGTTACTAGTTTGGTCTCAAATTCTGTAATAATTAGTTGAGAGCAAATGT[C/T]
AGGATTAAACCTGATGATTGTGCTGTCATAATAAATTTTTGCTCTGCTGTACTCCCTCCGTCCAAAAAAAAAAGGCAAACCCTATGTATGAATCTGGACA
TGTCCAGATTCATACATAGGGTTTGCCTTTTTTTTTTGGACGGAGGGAGTACAGCAGAGCAAAAATTTATTATGACAGCACAATCATCAGGTTTAATCCT[G/A]
ACATTTGCTCTCAACTAATTATTACAGAATTTGAGACCAAACTAGTAACATCACAACGAAATATGAAGGACACAACTAAACTGACAGAGGCATATATACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.90% | 18.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.70% | 19.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001366206 | C -> T | LOC_Os10g03240.1 | upstream_gene_variant ; 410.0bp to feature; MODIFIER | silent_mutation | Average:61.568; most accessible tissue: Callus, score: 93.708 | N | N | N | N |
| vg1001366206 | C -> T | LOC_Os10g03230-LOC_Os10g03240 | intergenic_region ; MODIFIER | silent_mutation | Average:61.568; most accessible tissue: Callus, score: 93.708 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001366206 | 1.11E-09 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001366206 | 4.97E-10 | 1.82E-13 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001366206 | 3.57E-08 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001366206 | 2.69E-08 | 1.79E-10 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001366206 | 5.86E-06 | NA | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001366206 | 2.88E-06 | 5.04E-07 | mr1588 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001366206 | 4.90E-06 | 4.90E-06 | mr1687 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001366206 | NA | 1.65E-07 | mr1721 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001366206 | 2.55E-07 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001366206 | 4.88E-08 | 5.94E-11 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001366206 | 2.37E-08 | NA | mr1721_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001366206 | 9.60E-08 | 3.27E-11 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |