\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001363211:

Variant ID: vg1001363211 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1363211
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTCGATCAAAATATTCATTTTTATTTCTGGTTTAACCTTACTAAGTAGGGATACATAATTAATTGTTTTGACTCTTACTTCTTTTTGGGTTTTTTTTT[G/T]
GTTGCCAGCTAGAATTATCTTAGCCTGGAGTCATATTCCCTTTATAACTATATTAATTAAGAGAGCTAAGAAGGATGGTCAAATTAGTGGTGTTATTCCA

Reverse complement sequence

TGGAATAACACCACTAATTTGACCATCCTTCTTAGCTCTCTTAATTAATATAGTTATAAAGGGAATATGACTCCAGGCTAAGATAATTCTAGCTGGCAAC[C/A]
AAAAAAAAACCCAAAAAGAAGTAAGAGTCAAAACAATTAATTATGTATCCCTACTTAGTAAGGTTAAACCAGAAATAAAAATGAATATTTTGATCGAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.50% 13.40% 1.84% 0.30% NA
All Indica  2759 89.60% 8.80% 1.23% 0.36% NA
All Japonica  1512 72.40% 24.40% 3.24% 0.00% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 70.80% 24.50% 4.73% 0.00% NA
Indica III  913 91.90% 6.50% 0.77% 0.88% NA
Indica Intermediate  786 90.50% 8.70% 0.64% 0.25% NA
Temperate Japonica  767 92.60% 4.00% 3.39% 0.00% NA
Tropical Japonica  504 41.50% 56.70% 1.79% 0.00% NA
Japonica Intermediate  241 72.60% 21.60% 5.81% 0.00% NA
VI/Aromatic  96 94.80% 0.00% 2.08% 3.12% NA
Intermediate  90 76.70% 21.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001363211 G -> T LOC_Os10g03240.1 upstream_gene_variant ; 3405.0bp to feature; MODIFIER silent_mutation Average:50.417; most accessible tissue: Minghui63 flag leaf, score: 72.907 N N N N
vg1001363211 G -> T LOC_Os10g03220.1 downstream_gene_variant ; 4030.0bp to feature; MODIFIER silent_mutation Average:50.417; most accessible tissue: Minghui63 flag leaf, score: 72.907 N N N N
vg1001363211 G -> T LOC_Os10g03230.1 downstream_gene_variant ; 2895.0bp to feature; MODIFIER silent_mutation Average:50.417; most accessible tissue: Minghui63 flag leaf, score: 72.907 N N N N
vg1001363211 G -> T LOC_Os10g03230-LOC_Os10g03240 intergenic_region ; MODIFIER silent_mutation Average:50.417; most accessible tissue: Minghui63 flag leaf, score: 72.907 N N N N
vg1001363211 G -> DEL N N silent_mutation Average:50.417; most accessible tissue: Minghui63 flag leaf, score: 72.907 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001363211 5.27E-06 9.22E-09 mr1054 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 1.63E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 1.98E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 6.99E-09 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 3.23E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 3.03E-09 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 3.97E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 1.86E-08 mr1287 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 5.96E-09 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 2.51E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 9.49E-06 mr1351 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 2.44E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 4.65E-06 6.25E-09 mr1372 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 7.49E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 5.81E-07 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 5.81E-07 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 1.19E-09 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 3.86E-06 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 3.66E-12 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 3.64E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 3.03E-07 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 7.67E-07 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 2.66E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 2.07E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 4.74E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 8.68E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 7.43E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 2.11E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 1.77E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 2.44E-07 mr1972 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 4.65E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 3.04E-08 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 4.79E-07 1.20E-14 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 3.04E-06 6.53E-11 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001363211 NA 6.45E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251