\
| Variant ID: vg1001340938 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1340938 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CATGGTCAGAATAAAGCACGGTCTGAATCCGCAGAATACTCAAGTGGTCAAAGTGGAGCCACCCAAAACGGACAGCCTAGTGAAATTCATGCAGAATTTC[T/C]
TGGAGAAGGAAACAACGATGCCCAGGAACCATTATTGGAAGATGCCGGTAAAATCACCCGTACCGGCCAAAAGGCTAGAGCAGCCAGCTCAGAAGAAGCC
GGCTTCTTCTGAGCTGGCTGCTCTAGCCTTTTGGCCGGTACGGGTGATTTTACCGGCATCTTCCAATAATGGTTCCTGGGCATCGTTGTTTCCTTCTCCA[A/G]
GAAATTCTGCATGAATTTCACTAGGCTGTCCGTTTTGGGTGGCTCCACTTTGACCACTTGAGTATTCTGCGGATTCAGACCGTGCTTTATTCTGACCATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.10% | 15.80% | 24.46% | 8.57% | NA |
| All Indica | 2759 | 57.60% | 3.00% | 34.90% | 4.49% | NA |
| All Japonica | 1512 | 43.50% | 33.20% | 5.36% | 17.92% | NA |
| Aus | 269 | 39.80% | 24.50% | 34.94% | 0.74% | NA |
| Indica I | 595 | 67.20% | 0.20% | 23.19% | 9.41% | NA |
| Indica II | 465 | 44.70% | 1.50% | 48.17% | 5.59% | NA |
| Indica III | 913 | 57.50% | 4.70% | 36.91% | 0.88% | NA |
| Indica Intermediate | 786 | 58.10% | 3.90% | 33.59% | 4.33% | NA |
| Temperate Japonica | 767 | 74.10% | 2.90% | 4.43% | 18.64% | NA |
| Tropical Japonica | 504 | 8.10% | 82.30% | 4.37% | 5.16% | NA |
| Japonica Intermediate | 241 | 20.30% | 27.00% | 10.37% | 42.32% | NA |
| VI/Aromatic | 96 | 13.50% | 82.30% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 22.20% | 15.56% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001340938 | T -> C | LOC_Os10g03160.1 | upstream_gene_variant ; 2975.0bp to feature; MODIFIER | silent_mutation | Average:41.312; most accessible tissue: Minghui63 flag leaf, score: 73.752 | N | N | N | N |
| vg1001340938 | T -> C | LOC_Os10g03180.1 | upstream_gene_variant ; 821.0bp to feature; MODIFIER | silent_mutation | Average:41.312; most accessible tissue: Minghui63 flag leaf, score: 73.752 | N | N | N | N |
| vg1001340938 | T -> C | LOC_Os10g03160-LOC_Os10g03180 | intergenic_region ; MODIFIER | silent_mutation | Average:41.312; most accessible tissue: Minghui63 flag leaf, score: 73.752 | N | N | N | N |
| vg1001340938 | T -> DEL | N | N | silent_mutation | Average:41.312; most accessible tissue: Minghui63 flag leaf, score: 73.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001340938 | NA | 7.77E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001340938 | NA | 4.34E-08 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001340938 | 3.34E-06 | 1.60E-07 | mr1291_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001340938 | NA | 1.09E-07 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001340938 | NA | 4.40E-06 | mr1479_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001340938 | NA | 5.34E-09 | mr1526_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001340938 | NA | 5.10E-09 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001340938 | NA | 2.42E-06 | mr1892_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |