\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001317449:

Variant ID: vg1001317449 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1317449
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.09, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGCTATGGTGGATTTGCTGGTAGAAAGATTCGATGCCCGTAACCCCTCAGGAGGTTCTCCTTTTATACCACAGATCACCTTGACCTCCAAGTAAGACT[C/T]
GAAGATGTTGGACCCCGTACAGTATAGAGAACAGGAACCTCTCCGAGTAGGACTCTGTTGTCTCCCAACTGATCAAGATAATTTTCATAATAGCCGTAAT

Reverse complement sequence

ATTACGGCTATTATGAAAATTATCTTGATCAGTTGGGAGACAACAGAGTCCTACTCGGAGAGGTTCCTGTTCTCTATACTGTACGGGGTCCAACATCTTC[G/A]
AGTCTTACTTGGAGGTCAAGGTGATCTGTGGTATAAAAGGAGAACCTCCTGAGGGGTTACGGGCATCGAATCTTTCTACCAGCAAATCCACCATAGCCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.40% 27.00% 0.70% 31.87% NA
All Indica  2759 24.20% 44.30% 0.72% 30.74% NA
All Japonica  1512 60.00% 2.30% 0.46% 37.24% NA
Aus  269 93.30% 1.10% 0.00% 5.58% NA
Indica I  595 15.80% 60.70% 1.18% 22.35% NA
Indica II  465 16.30% 35.90% 1.08% 46.67% NA
Indica III  913 33.50% 35.50% 0.44% 30.56% NA
Indica Intermediate  786 24.60% 47.10% 0.51% 27.86% NA
Temperate Japonica  767 85.00% 0.80% 0.26% 13.95% NA
Tropical Japonica  504 31.30% 4.20% 0.60% 63.89% NA
Japonica Intermediate  241 40.20% 3.30% 0.83% 55.60% NA
VI/Aromatic  96 37.50% 3.10% 4.17% 55.21% NA
Intermediate  90 53.30% 14.40% 2.22% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001317449 C -> T LOC_Os10g03110.1 upstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:34.255; most accessible tissue: Callus, score: 68.679 N N N N
vg1001317449 C -> T LOC_Os10g03120.1 upstream_gene_variant ; 611.0bp to feature; MODIFIER silent_mutation Average:34.255; most accessible tissue: Callus, score: 68.679 N N N N
vg1001317449 C -> T LOC_Os10g03130.1 downstream_gene_variant ; 4559.0bp to feature; MODIFIER silent_mutation Average:34.255; most accessible tissue: Callus, score: 68.679 N N N N
vg1001317449 C -> T LOC_Os10g03110-LOC_Os10g03120 intergenic_region ; MODIFIER silent_mutation Average:34.255; most accessible tissue: Callus, score: 68.679 N N N N
vg1001317449 C -> DEL N N silent_mutation Average:34.255; most accessible tissue: Callus, score: 68.679 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001317449 NA 7.83E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001317449 4.66E-06 NA mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001317449 4.78E-06 4.78E-06 mr1264_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001317449 8.58E-06 NA mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251