\
| Variant ID: vg1001317449 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1317449 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.09, others allele: 0.00, population size: 55. )
TAGGCTATGGTGGATTTGCTGGTAGAAAGATTCGATGCCCGTAACCCCTCAGGAGGTTCTCCTTTTATACCACAGATCACCTTGACCTCCAAGTAAGACT[C/T]
GAAGATGTTGGACCCCGTACAGTATAGAGAACAGGAACCTCTCCGAGTAGGACTCTGTTGTCTCCCAACTGATCAAGATAATTTTCATAATAGCCGTAAT
ATTACGGCTATTATGAAAATTATCTTGATCAGTTGGGAGACAACAGAGTCCTACTCGGAGAGGTTCCTGTTCTCTATACTGTACGGGGTCCAACATCTTC[G/A]
AGTCTTACTTGGAGGTCAAGGTGATCTGTGGTATAAAAGGAGAACCTCCTGAGGGGTTACGGGCATCGAATCTTTCTACCAGCAAATCCACCATAGCCTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.40% | 27.00% | 0.70% | 31.87% | NA |
| All Indica | 2759 | 24.20% | 44.30% | 0.72% | 30.74% | NA |
| All Japonica | 1512 | 60.00% | 2.30% | 0.46% | 37.24% | NA |
| Aus | 269 | 93.30% | 1.10% | 0.00% | 5.58% | NA |
| Indica I | 595 | 15.80% | 60.70% | 1.18% | 22.35% | NA |
| Indica II | 465 | 16.30% | 35.90% | 1.08% | 46.67% | NA |
| Indica III | 913 | 33.50% | 35.50% | 0.44% | 30.56% | NA |
| Indica Intermediate | 786 | 24.60% | 47.10% | 0.51% | 27.86% | NA |
| Temperate Japonica | 767 | 85.00% | 0.80% | 0.26% | 13.95% | NA |
| Tropical Japonica | 504 | 31.30% | 4.20% | 0.60% | 63.89% | NA |
| Japonica Intermediate | 241 | 40.20% | 3.30% | 0.83% | 55.60% | NA |
| VI/Aromatic | 96 | 37.50% | 3.10% | 4.17% | 55.21% | NA |
| Intermediate | 90 | 53.30% | 14.40% | 2.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001317449 | C -> T | LOC_Os10g03110.1 | upstream_gene_variant ; 985.0bp to feature; MODIFIER | silent_mutation | Average:34.255; most accessible tissue: Callus, score: 68.679 | N | N | N | N |
| vg1001317449 | C -> T | LOC_Os10g03120.1 | upstream_gene_variant ; 611.0bp to feature; MODIFIER | silent_mutation | Average:34.255; most accessible tissue: Callus, score: 68.679 | N | N | N | N |
| vg1001317449 | C -> T | LOC_Os10g03130.1 | downstream_gene_variant ; 4559.0bp to feature; MODIFIER | silent_mutation | Average:34.255; most accessible tissue: Callus, score: 68.679 | N | N | N | N |
| vg1001317449 | C -> T | LOC_Os10g03110-LOC_Os10g03120 | intergenic_region ; MODIFIER | silent_mutation | Average:34.255; most accessible tissue: Callus, score: 68.679 | N | N | N | N |
| vg1001317449 | C -> DEL | N | N | silent_mutation | Average:34.255; most accessible tissue: Callus, score: 68.679 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001317449 | NA | 7.83E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001317449 | 4.66E-06 | NA | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001317449 | 4.78E-06 | 4.78E-06 | mr1264_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001317449 | 8.58E-06 | NA | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |