\
| Variant ID: vg1001300052 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1300052 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 59. )
ACCATTAAATATAACCATAATTGGTAGTGTAGTATGAATCACCCCATTAATGAGCTAATATTTCTAAGCATGACTAAGCATCTATAATAATCATATAGCT[G/A]
AACCAAACCAATATATAAGGTTCTAGCTAATCAAATTATAACCCATAGGAAAATAAAGTTATCTTCGGCCATAATTAAATGGGAAAGGCTCACCACCCGG
CCGGGTGGTGAGCCTTTCCCATTTAATTATGGCCGAAGATAACTTTATTTTCCTATGGGTTATAATTTGATTAGCTAGAACCTTATATATTGGTTTGGTT[C/T]
AGCTATATGATTATTATAGATGCTTAGTCATGCTTAGAAATATTAGCTCATTAATGGGGTGATTCATACTACACTACCAATTATGGTTATATTTAATGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.10% | 26.90% | 12.31% | 18.62% | NA |
| All Indica | 2759 | 25.80% | 44.10% | 18.45% | 11.63% | NA |
| All Japonica | 1512 | 62.20% | 2.20% | 2.98% | 32.61% | NA |
| Aus | 269 | 93.70% | 1.10% | 1.49% | 3.72% | NA |
| Indica I | 595 | 17.00% | 60.50% | 7.73% | 14.79% | NA |
| Indica II | 465 | 19.60% | 35.70% | 30.75% | 13.98% | NA |
| Indica III | 913 | 33.80% | 35.60% | 21.14% | 9.42% | NA |
| Indica Intermediate | 786 | 26.80% | 46.60% | 16.16% | 10.43% | NA |
| Temperate Japonica | 767 | 87.20% | 0.80% | 1.96% | 10.04% | NA |
| Tropical Japonica | 504 | 33.50% | 4.20% | 4.37% | 57.94% | NA |
| Japonica Intermediate | 241 | 42.30% | 2.90% | 3.32% | 51.45% | NA |
| VI/Aromatic | 96 | 38.50% | 3.10% | 14.58% | 43.75% | NA |
| Intermediate | 90 | 56.70% | 16.70% | 11.11% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001300052 | G -> A | LOC_Os10g03090.1 | upstream_gene_variant ; 937.0bp to feature; MODIFIER | silent_mutation | Average:40.316; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg1001300052 | G -> A | LOC_Os10g03080-LOC_Os10g03090 | intergenic_region ; MODIFIER | silent_mutation | Average:40.316; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg1001300052 | G -> DEL | N | N | silent_mutation | Average:40.316; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001300052 | NA | 6.40E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | NA | 2.81E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | NA | 4.99E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | 7.72E-08 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | 4.05E-06 | 2.87E-07 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | 2.66E-08 | NA | mr1548 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | 1.12E-06 | 7.89E-07 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | NA | 4.53E-07 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | NA | 6.88E-06 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | NA | 1.84E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | NA | 5.46E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | NA | 2.48E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | NA | 1.57E-06 | mr1858 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | NA | 1.58E-06 | mr1859 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | 1.53E-06 | 6.12E-09 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001300052 | NA | 5.11E-11 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |