\
| Variant ID: vg1001274276 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1274276 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, T: 0.14, others allele: 0.00, population size: 55. )
TAAGAAATAGCAACAAGCATTTCTGGCGCCGTTGCCGGGAAAGATTTATAAAAGAGATTACTATAAGCTAATACTTTATATTTACCCTTGTATAGTCCCT[G/T,A]
TCCTTTGCAGGCTAACCTTGGTTGTTTTCACTGTTGTTGTGAAAACAGGGTAGTGTATGACTGGTTTCAACTTACCGGAAAATTTCAAAGAAAATCCAAA
TTTGGATTTTCTTTGAAATTTTCCGGTAAGTTGAAACCAGTCATACACTACCCTGTTTTCACAACAACAGTGAAAACAACCAAGGTTAGCCTGCAAAGGA[C/A,T]
AGGGACTATACAAGGGTAAATATAAAGTATTAGCTTATAGTAATCTCTTTTATAAATCTTTCCCGGCAACGGCGCCAGAAATGCTTGTTGCTATTTCTTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.50% | 25.90% | 3.91% | 34.49% | A: 0.23% |
| All Indica | 2759 | 49.70% | 11.30% | 1.16% | 37.80% | NA |
| All Japonica | 1512 | 8.10% | 55.00% | 6.42% | 30.49% | NA |
| Aus | 269 | 57.20% | 7.10% | 18.22% | 13.38% | A: 4.09% |
| Indica I | 595 | 62.90% | 10.80% | 2.02% | 24.37% | NA |
| Indica II | 465 | 36.80% | 9.90% | 1.51% | 51.83% | NA |
| Indica III | 913 | 42.70% | 13.60% | 0.22% | 43.48% | NA |
| Indica Intermediate | 786 | 55.50% | 10.10% | 1.40% | 33.08% | NA |
| Temperate Japonica | 767 | 1.20% | 81.60% | 4.17% | 13.04% | NA |
| Tropical Japonica | 504 | 20.20% | 17.90% | 6.35% | 55.56% | NA |
| Japonica Intermediate | 241 | 4.60% | 48.10% | 13.69% | 33.61% | NA |
| VI/Aromatic | 96 | 3.10% | 31.20% | 3.12% | 62.50% | NA |
| Intermediate | 90 | 30.00% | 32.20% | 4.44% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001274276 | G -> T | LOC_Os10g03060.1 | upstream_gene_variant ; 328.0bp to feature; MODIFIER | silent_mutation | Average:32.426; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
| vg1001274276 | G -> T | LOC_Os10g03070.1 | downstream_gene_variant ; 4575.0bp to feature; MODIFIER | silent_mutation | Average:32.426; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
| vg1001274276 | G -> T | LOC_Os10g03050-LOC_Os10g03060 | intergenic_region ; MODIFIER | silent_mutation | Average:32.426; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
| vg1001274276 | G -> A | LOC_Os10g03060.1 | upstream_gene_variant ; 328.0bp to feature; MODIFIER | silent_mutation | Average:32.426; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
| vg1001274276 | G -> A | LOC_Os10g03070.1 | downstream_gene_variant ; 4575.0bp to feature; MODIFIER | silent_mutation | Average:32.426; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
| vg1001274276 | G -> A | LOC_Os10g03050-LOC_Os10g03060 | intergenic_region ; MODIFIER | silent_mutation | Average:32.426; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
| vg1001274276 | G -> DEL | N | N | silent_mutation | Average:32.426; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001274276 | 7.14E-06 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001274276 | 7.84E-16 | 4.09E-15 | mr1486 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001274276 | 7.10E-06 | 5.11E-23 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001274276 | 5.94E-15 | 3.34E-14 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001274276 | 8.50E-09 | 1.75E-08 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001274276 | 2.18E-09 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001274276 | 1.15E-16 | 1.16E-14 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001274276 | 8.34E-08 | 1.93E-24 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001274276 | 4.62E-19 | 1.01E-16 | mr1588_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |