\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001274276:

Variant ID: vg1001274276 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1274276
Reference Allele: GAlternative Allele: T,A
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, T: 0.14, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGAAATAGCAACAAGCATTTCTGGCGCCGTTGCCGGGAAAGATTTATAAAAGAGATTACTATAAGCTAATACTTTATATTTACCCTTGTATAGTCCCT[G/T,A]
TCCTTTGCAGGCTAACCTTGGTTGTTTTCACTGTTGTTGTGAAAACAGGGTAGTGTATGACTGGTTTCAACTTACCGGAAAATTTCAAAGAAAATCCAAA

Reverse complement sequence

TTTGGATTTTCTTTGAAATTTTCCGGTAAGTTGAAACCAGTCATACACTACCCTGTTTTCACAACAACAGTGAAAACAACCAAGGTTAGCCTGCAAAGGA[C/A,T]
AGGGACTATACAAGGGTAAATATAAAGTATTAGCTTATAGTAATCTCTTTTATAAATCTTTCCCGGCAACGGCGCCAGAAATGCTTGTTGCTATTTCTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.50% 25.90% 3.91% 34.49% A: 0.23%
All Indica  2759 49.70% 11.30% 1.16% 37.80% NA
All Japonica  1512 8.10% 55.00% 6.42% 30.49% NA
Aus  269 57.20% 7.10% 18.22% 13.38% A: 4.09%
Indica I  595 62.90% 10.80% 2.02% 24.37% NA
Indica II  465 36.80% 9.90% 1.51% 51.83% NA
Indica III  913 42.70% 13.60% 0.22% 43.48% NA
Indica Intermediate  786 55.50% 10.10% 1.40% 33.08% NA
Temperate Japonica  767 1.20% 81.60% 4.17% 13.04% NA
Tropical Japonica  504 20.20% 17.90% 6.35% 55.56% NA
Japonica Intermediate  241 4.60% 48.10% 13.69% 33.61% NA
VI/Aromatic  96 3.10% 31.20% 3.12% 62.50% NA
Intermediate  90 30.00% 32.20% 4.44% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001274276 G -> T LOC_Os10g03060.1 upstream_gene_variant ; 328.0bp to feature; MODIFIER silent_mutation Average:32.426; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1001274276 G -> T LOC_Os10g03070.1 downstream_gene_variant ; 4575.0bp to feature; MODIFIER silent_mutation Average:32.426; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1001274276 G -> T LOC_Os10g03050-LOC_Os10g03060 intergenic_region ; MODIFIER silent_mutation Average:32.426; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1001274276 G -> A LOC_Os10g03060.1 upstream_gene_variant ; 328.0bp to feature; MODIFIER silent_mutation Average:32.426; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1001274276 G -> A LOC_Os10g03070.1 downstream_gene_variant ; 4575.0bp to feature; MODIFIER silent_mutation Average:32.426; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1001274276 G -> A LOC_Os10g03050-LOC_Os10g03060 intergenic_region ; MODIFIER silent_mutation Average:32.426; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1001274276 G -> DEL N N silent_mutation Average:32.426; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001274276 7.14E-06 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001274276 7.84E-16 4.09E-15 mr1486 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001274276 7.10E-06 5.11E-23 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001274276 5.94E-15 3.34E-14 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001274276 8.50E-09 1.75E-08 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001274276 2.18E-09 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001274276 1.15E-16 1.16E-14 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001274276 8.34E-08 1.93E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001274276 4.62E-19 1.01E-16 mr1588_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251