\
| Variant ID: vg1001247140 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1247140 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.02, others allele: 0.00, population size: 59. )
AAAAAGTCAAAAAGTTACCTTTGCTTCTCCCCCTTTTGACAATGATTTCATCAAGCATAGGAATTATGTTCATTAATGTTCAAGAGCTTAGCATACATAT[A/G]
GCATATCATGTCATGTGTTGCAATAAAAAGAAGATAAACTCATCTATAATATAACAAGCATGCATTAAAGTATAACCATGAACCAAAGACTTTACAATTA
TAATTGTAAAGTCTTTGGTTCATGGTTATACTTTAATGCATGCTTGTTATATTATAGATGAGTTTATCTTCTTTTTATTGCAACACATGACATGATATGC[T/C]
ATATGTATGCTAAGCTCTTGAACATTAATGAACATAATTCCTATGCTTGATGAAATCATTGTCAAAAGGGGGAGAAGCAAAGGTAACTTTTTGACTTTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.90% | 7.60% | 5.08% | 27.47% | NA |
| All Indica | 2759 | 65.00% | 10.30% | 6.60% | 18.12% | NA |
| All Japonica | 1512 | 51.70% | 1.50% | 2.05% | 44.71% | NA |
| Aus | 269 | 56.50% | 16.00% | 6.32% | 21.19% | NA |
| Indica I | 595 | 58.20% | 2.20% | 8.91% | 30.76% | NA |
| Indica II | 465 | 50.30% | 19.60% | 9.46% | 20.65% | NA |
| Indica III | 913 | 76.10% | 14.00% | 3.40% | 6.46% | NA |
| Indica Intermediate | 786 | 65.90% | 6.60% | 6.87% | 20.61% | NA |
| Temperate Japonica | 767 | 74.80% | 0.10% | 1.17% | 23.86% | NA |
| Tropical Japonica | 504 | 25.40% | 2.60% | 2.18% | 69.84% | NA |
| Japonica Intermediate | 241 | 33.20% | 3.70% | 4.56% | 58.51% | NA |
| VI/Aromatic | 96 | 50.00% | 0.00% | 5.21% | 44.79% | NA |
| Intermediate | 90 | 60.00% | 10.00% | 5.56% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001247140 | A -> G | LOC_Os10g02990.1 | upstream_gene_variant ; 1480.0bp to feature; MODIFIER | silent_mutation | Average:6.833; most accessible tissue: Callus, score: 14.361 | N | N | N | N |
| vg1001247140 | A -> G | LOC_Os10g03000.1 | downstream_gene_variant ; 778.0bp to feature; MODIFIER | silent_mutation | Average:6.833; most accessible tissue: Callus, score: 14.361 | N | N | N | N |
| vg1001247140 | A -> G | LOC_Os10g03010.1 | downstream_gene_variant ; 3562.0bp to feature; MODIFIER | silent_mutation | Average:6.833; most accessible tissue: Callus, score: 14.361 | N | N | N | N |
| vg1001247140 | A -> G | LOC_Os10g02990-LOC_Os10g03000 | intergenic_region ; MODIFIER | silent_mutation | Average:6.833; most accessible tissue: Callus, score: 14.361 | N | N | N | N |
| vg1001247140 | A -> DEL | N | N | silent_mutation | Average:6.833; most accessible tissue: Callus, score: 14.361 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001247140 | 3.09E-15 | 2.50E-52 | mr1039 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247140 | 2.66E-08 | 1.90E-34 | mr1039 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247140 | 5.67E-11 | NA | mr1632 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247140 | 5.11E-08 | 1.56E-13 | mr1632 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247140 | NA | 5.75E-06 | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247140 | 7.16E-16 | 3.37E-48 | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247140 | 2.02E-11 | 9.70E-34 | mr1039_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247140 | 4.84E-07 | NA | mr1514_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247140 | 3.75E-07 | 2.79E-08 | mr1514_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247140 | 9.84E-12 | NA | mr1632_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247140 | 8.87E-10 | 8.03E-21 | mr1632_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247140 | NA | 4.23E-07 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |