\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001247140:

Variant ID: vg1001247140 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1247140
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.02, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGTCAAAAAGTTACCTTTGCTTCTCCCCCTTTTGACAATGATTTCATCAAGCATAGGAATTATGTTCATTAATGTTCAAGAGCTTAGCATACATAT[A/G]
GCATATCATGTCATGTGTTGCAATAAAAAGAAGATAAACTCATCTATAATATAACAAGCATGCATTAAAGTATAACCATGAACCAAAGACTTTACAATTA

Reverse complement sequence

TAATTGTAAAGTCTTTGGTTCATGGTTATACTTTAATGCATGCTTGTTATATTATAGATGAGTTTATCTTCTTTTTATTGCAACACATGACATGATATGC[T/C]
ATATGTATGCTAAGCTCTTGAACATTAATGAACATAATTCCTATGCTTGATGAAATCATTGTCAAAAGGGGGAGAAGCAAAGGTAACTTTTTGACTTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 7.60% 5.08% 27.47% NA
All Indica  2759 65.00% 10.30% 6.60% 18.12% NA
All Japonica  1512 51.70% 1.50% 2.05% 44.71% NA
Aus  269 56.50% 16.00% 6.32% 21.19% NA
Indica I  595 58.20% 2.20% 8.91% 30.76% NA
Indica II  465 50.30% 19.60% 9.46% 20.65% NA
Indica III  913 76.10% 14.00% 3.40% 6.46% NA
Indica Intermediate  786 65.90% 6.60% 6.87% 20.61% NA
Temperate Japonica  767 74.80% 0.10% 1.17% 23.86% NA
Tropical Japonica  504 25.40% 2.60% 2.18% 69.84% NA
Japonica Intermediate  241 33.20% 3.70% 4.56% 58.51% NA
VI/Aromatic  96 50.00% 0.00% 5.21% 44.79% NA
Intermediate  90 60.00% 10.00% 5.56% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001247140 A -> G LOC_Os10g02990.1 upstream_gene_variant ; 1480.0bp to feature; MODIFIER silent_mutation Average:6.833; most accessible tissue: Callus, score: 14.361 N N N N
vg1001247140 A -> G LOC_Os10g03000.1 downstream_gene_variant ; 778.0bp to feature; MODIFIER silent_mutation Average:6.833; most accessible tissue: Callus, score: 14.361 N N N N
vg1001247140 A -> G LOC_Os10g03010.1 downstream_gene_variant ; 3562.0bp to feature; MODIFIER silent_mutation Average:6.833; most accessible tissue: Callus, score: 14.361 N N N N
vg1001247140 A -> G LOC_Os10g02990-LOC_Os10g03000 intergenic_region ; MODIFIER silent_mutation Average:6.833; most accessible tissue: Callus, score: 14.361 N N N N
vg1001247140 A -> DEL N N silent_mutation Average:6.833; most accessible tissue: Callus, score: 14.361 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001247140 3.09E-15 2.50E-52 mr1039 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247140 2.66E-08 1.90E-34 mr1039 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247140 5.67E-11 NA mr1632 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247140 5.11E-08 1.56E-13 mr1632 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247140 NA 5.75E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247140 7.16E-16 3.37E-48 mr1039_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247140 2.02E-11 9.70E-34 mr1039_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247140 4.84E-07 NA mr1514_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247140 3.75E-07 2.79E-08 mr1514_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247140 9.84E-12 NA mr1632_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247140 8.87E-10 8.03E-21 mr1632_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247140 NA 4.23E-07 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251