\
| Variant ID: vg1001243731 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1243731 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 227. )
AATTTCTATGCTTTCCTCTTCTGCTGTTGTGGGTGCTGTAGGCCGTTCATCCAATATTTCTTTGACCAATGTATGTTGCTGTTCTGATGACAAAAGAGTT[T/C]
GCAACAATTCCATAGGATGCTTCCCCATTACCACCTCTAGAACAACAACACCAAAGCTATAAACATCACATTTCTCTGTCACGACACATGTGAAGGACAG
CTGTCCTTCACATGTGTCGTGACAGAGAAATGTGATGTTTATAGCTTTGGTGTTGTTGTTCTAGAGGTGGTAATGGGGAAGCATCCTATGGAATTGTTGC[A/G]
AACTCTTTTGTCATCAGAACAGCAACATACATTGGTCAAAGAAATATTGGATGAACGGCCTACAGCACCCACAACAGCAGAAGAGGAAAGCATAGAAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.00% | 36.80% | 0.53% | 24.71% | NA |
| All Indica | 2759 | 51.20% | 6.60% | 0.83% | 41.36% | NA |
| All Japonica | 1512 | 5.90% | 93.10% | 0.07% | 0.99% | NA |
| Aus | 269 | 94.80% | 4.80% | 0.00% | 0.37% | NA |
| Indica I | 595 | 42.40% | 2.90% | 0.50% | 54.29% | NA |
| Indica II | 465 | 65.40% | 4.70% | 0.65% | 29.25% | NA |
| Indica III | 913 | 52.50% | 8.30% | 0.44% | 38.77% | NA |
| Indica Intermediate | 786 | 48.00% | 8.70% | 1.65% | 41.73% | NA |
| Temperate Japonica | 767 | 1.20% | 98.40% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 14.90% | 82.70% | 0.20% | 2.18% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.50% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 6.20% | 90.60% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 37.80% | 52.20% | 1.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001243731 | T -> C | LOC_Os10g02990.1 | missense_variant ; p.Gln545Arg; MODERATE | nonsynonymous_codon ; Q545R | Average:51.035; most accessible tissue: Callus, score: 93.142 | unknown | unknown | TOLERATED | 0.08 |
| vg1001243731 | T -> DEL | LOC_Os10g02990.1 | N | frameshift_variant | Average:51.035; most accessible tissue: Callus, score: 93.142 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001243731 | 9.42E-07 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001243731 | 2.27E-10 | 6.93E-09 | mr1486 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001243731 | 1.05E-06 | 1.54E-24 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001243731 | 1.22E-09 | 1.45E-08 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001243731 | NA | 8.36E-21 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001243731 | 1.50E-07 | 2.54E-06 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001243731 | 1.15E-06 | 4.90E-46 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001243731 | 7.16E-11 | 1.39E-08 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001243731 | NA | 7.53E-06 | mr1530_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001243731 | 5.81E-07 | 4.01E-25 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001243731 | 6.50E-12 | 3.48E-07 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |