Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1001243005:

Variant ID: vg1001243005 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1243005
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, A: 0.34, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGTGGCCTCTTCTTCCCCTCCGCCGGCGGCAATCGGCGAAGACGGTGATGTCGGAGGTTCCAAGGCCGCAGGCGCGCGTGCCATATATCTTCACGACC[A/T]
TCTCTTTAAATTCTCCTTCTGATAGCCTACACTTGAATCGATCGATCATTCATATCTGTCGATTGAGAAAAGTTCATTCAAGTGAAGATTATTCATATCG

Reverse complement sequence

CGATATGAATAATCTTCACTTGAATGAACTTTTCTCAATCGACAGATATGAATGATCGATCGATTCAAGTGTAGGCTATCAGAAGGAGAATTTAAAGAGA[T/A]
GGTCGTGAAGATATATGGCACGCGCGCCTGCGGCCTTGGAACCTCCGACATCACCGTCTTCGCCGATTGCCGCCGGCGGAGGGGAAGAAGAGGCCACCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	36.20%	0.11%	1.33%	NA
All Indica	2759	91.80%	5.90%	0.14%	2.14%	NA
All Japonica	1512	6.90%	93.10%	0.00%	0.00%	NA
Aus	269	95.20%	4.50%	0.37%	0.00%	NA
Indica I	595	97.60%	2.40%	0.00%	0.00%	NA
Indica II	465	94.60%	4.30%	0.43%	0.65%	NA
Indica III	913	87.30%	7.30%	0.00%	5.37%	NA
Indica Intermediate	786	91.10%	7.80%	0.25%	0.89%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	17.10%	82.90%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	90.60%	0.00%	3.12%	NA
Intermediate	90	50.00%	48.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001243005	A -> T	LOC_Os10g02980.1	downstream_gene_variant ; 1233.0bp to feature; MODIFIER	silent_mutation	Average:51.565; most accessible tissue: Callus, score: 83.108	N	N	N	N
vg1001243005	A -> T	LOC_Os10g02990.1	downstream_gene_variant ; 473.0bp to feature; MODIFIER	silent_mutation	Average:51.565; most accessible tissue: Callus, score: 83.108	N	N	N	N
vg1001243005	A -> T	LOC_Os10g03000.1	downstream_gene_variant ; 4913.0bp to feature; MODIFIER	silent_mutation	Average:51.565; most accessible tissue: Callus, score: 83.108	N	N	N	N
vg1001243005	A -> T	LOC_Os10g02980-LOC_Os10g02990	intergenic_region ; MODIFIER	silent_mutation	Average:51.565; most accessible tissue: Callus, score: 83.108	N	N	N	N
vg1001243005	A -> DEL	N	N	silent_mutation	Average:51.565; most accessible tissue: Callus, score: 83.108	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001243005	2.62E-07	3.13E-36	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001243005	2.63E-10	8.17E-10	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001243005	3.29E-07	1.46E-25	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001243005	6.66E-10	3.60E-09	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001243005	5.27E-06	1.94E-22	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001243005	1.35E-08	2.42E-07	mr1588	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001243005	3.28E-07	7.82E-48	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001243005	4.65E-11	6.21E-10	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001243005	2.86E-08	6.65E-27	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001243005	4.79E-13	1.41E-08	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251