Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001168844:

Variant ID: vg1001168844 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1168844
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAGAGTATTCAAATCTTGATTGTGGTAACTTAATACAAAGATTCCTGTATTTTTCCTACTACCAACTATCTATAAGAGTCATTCCTATACTTTTCCTAT[C/G]
CTTAGTTTTGCATATGCATTCCTATATTATTCCTTCGTTTTTCCTATTGCTATGATTTGAAATTAAGCGAATAGGCCCTTAATTTCCAAACAAAAACTTT

Reverse complement sequence

AAAGTTTTTGTTTGGAAATTAAGGGCCTATTCGCTTAATTTCAAATCATAGCAATAGGAAAAACGAAGGAATAATATAGGAATGCATATGCAAAACTAAG[G/C]
ATAGGAAAAGTATAGGAATGACTCTTATAGATAGTTGGTAGTAGGAAAAATACAGGAATCTTTGTATTAAGTTACCACAATCAAGATTTGAATACTCTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.20%	14.40%	0.04%	2.41%	NA
All Indica	2759	95.30%	4.60%	0.04%	0.04%	NA
All Japonica	1512	64.70%	35.30%	0.00%	0.00%	NA
Aus	269	57.20%	1.50%	0.00%	41.26%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	89.40%	10.60%	0.00%	0.00%	NA
Indica Intermediate	786	96.90%	2.80%	0.13%	0.13%	NA
Temperate Japonica	767	33.50%	66.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	91.70%	8.30%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	13.30%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001168844	C -> G	LOC_Os10g02880.1	upstream_gene_variant ; 4359.0bp to feature; MODIFIER	silent_mutation	Average:25.338; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N
vg1001168844	C -> G	LOC_Os10g02880-LOC_Os10g02890	intergenic_region ; MODIFIER	silent_mutation	Average:25.338; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N
vg1001168844	C -> DEL	N	N	silent_mutation	Average:25.338; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001168844	NA	1.26E-06	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	3.95E-22	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	1.86E-29	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	1.13E-08	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	1.14E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	9.26E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	5.68E-07	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	6.81E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	7.71E-06	NA	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	8.80E-06	3.12E-38	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	1.65E-12	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	4.11E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	2.77E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	2.75E-09	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	4.49E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	8.74E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	3.29E-06	2.21E-25	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	2.40E-13	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	1.33E-06	1.50E-29	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	4.36E-10	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	2.46E-09	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	1.03E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	2.18E-07	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	5.72E-08	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	6.09E-08	6.58E-27	mr1920	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	4.04E-12	mr1920	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	8.78E-06	NA	mr1932	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	1.33E-06	mr1937	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	6.36E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	5.93E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	4.24E-06	2.62E-33	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	1.50E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	1.16E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	1.44E-08	1.29E-45	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	6.32E-06	1.86E-14	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	4.33E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	1.28E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001168844	NA	6.48E-14	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251