\
| Variant ID: vg1000966667 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 966667 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGCTAAGACCTGCAAGAGATAATATTGTGGATGGTTAAGGATCAAAACATGATTGGCCGATCTCAGATTTGTATCAACAAAAACTTACTGGAATAGCAGG[G/A]
GCAGCTGGTTGTTCTTCCTCTTCGACGTTGTGGCTGTCTGCAGCCGATGGAGTACGGTTGCCTGATTCTAGCTGCACAGGAGGTGAAGGAGGACGAGGAG
CTCCTCGTCCTCCTTCACCTCCTGTGCAGCTAGAATCAGGCAACCGTACTCCATCGGCTGCAGACAGCCACAACGTCGAAGAGGAAGAACAACCAGCTGC[C/T]
CCTGCTATTCCAGTAAGTTTTTGTTGATACAAATCTGAGATCGGCCAATCATGTTTTGATCCTTAACCATCCACAATATTATCTCTTGCAGGTCTTAGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.80% | 33.90% | 3.79% | 1.50% | NA |
| All Indica | 2759 | 92.20% | 3.10% | 3.95% | 0.72% | NA |
| All Japonica | 1512 | 3.80% | 89.90% | 2.91% | 3.31% | NA |
| Aus | 269 | 85.50% | 6.30% | 8.18% | 0.00% | NA |
| Indica I | 595 | 92.40% | 3.50% | 3.53% | 0.50% | NA |
| Indica II | 465 | 93.80% | 2.80% | 2.58% | 0.86% | NA |
| Indica III | 913 | 93.40% | 1.90% | 4.27% | 0.44% | NA |
| Indica Intermediate | 786 | 89.80% | 4.30% | 4.71% | 1.15% | NA |
| Temperate Japonica | 767 | 1.30% | 97.70% | 0.39% | 0.65% | NA |
| Tropical Japonica | 504 | 4.00% | 82.10% | 7.94% | 5.95% | NA |
| Japonica Intermediate | 241 | 11.60% | 81.70% | 0.41% | 6.22% | NA |
| VI/Aromatic | 96 | 9.40% | 89.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 58.90% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000966667 | G -> A | LOC_Os10g02560.1 | synonymous_variant ; p.Ala566Ala; LOW | synonymous_codon | Average:25.191; most accessible tissue: Zhenshan97 young leaf, score: 34.553 | N | N | N | N |
| vg1000966667 | G -> DEL | LOC_Os10g02560.1 | N | frameshift_variant | Average:25.191; most accessible tissue: Zhenshan97 young leaf, score: 34.553 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000966667 | NA | 1.48E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | NA | 1.03E-09 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | NA | 1.13E-16 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | NA | 1.75E-15 | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | NA | 1.58E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | NA | 2.07E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | NA | 8.36E-13 | mr1335 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | NA | 7.13E-86 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | NA | 1.01E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | NA | 1.48E-12 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | NA | 5.09E-12 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | NA | 1.96E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | NA | 7.39E-22 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | 5.53E-07 | NA | mr1172_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | NA | 2.44E-12 | mr1553_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000966667 | NA | 4.08E-10 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |