\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000958635:

Variant ID: vg1000958635 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 958635
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTACAATCGGCTAACATCTGTTGGTAGAAGGCGGCCGATTAGGTTAAATAGCAATATTAGCTTGGATTGTATAAAGTATCTACCACTCTATGAAACATC[T/C]
AGCAGCTTGATTGTCTAGATATTGTTCTTCTTTTCATACTTAATGCTGCATCAGTTGAGTTTGATCTATTAAGTCGTGCTTAGAATATCAATCTCTAGCC

Reverse complement sequence

GGCTAGAGATTGATATTCTAAGCACGACTTAATAGATCAAACTCAACTGATGCAGCATTAAGTATGAAAAGAAGAACAATATCTAGACAATCAAGCTGCT[A/G]
GATGTTTCATAGAGTGGTAGATACTTTATACAATCCAAGCTAATATTGCTATTTAACCTAATCGGCCGCCTTCTACCAACAGATGTTAGCCGATTGTAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.00% 5.20% 1.97% 63.82% NA
All Indica  2759 3.50% 0.20% 2.90% 93.40% NA
All Japonica  1512 81.00% 9.10% 0.20% 9.72% NA
Aus  269 4.50% 1.90% 2.60% 91.08% NA
Indica I  595 4.00% 0.20% 3.03% 92.77% NA
Indica II  465 4.50% 0.00% 5.38% 90.11% NA
Indica III  913 1.60% 0.10% 2.19% 96.06% NA
Indica Intermediate  786 4.70% 0.40% 2.16% 92.75% NA
Temperate Japonica  767 81.70% 16.00% 0.26% 1.96% NA
Tropical Japonica  504 81.70% 0.80% 0.00% 17.46% NA
Japonica Intermediate  241 77.20% 4.10% 0.41% 18.26% NA
VI/Aromatic  96 1.00% 88.50% 0.00% 10.42% NA
Intermediate  90 38.90% 16.70% 3.33% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000958635 T -> C LOC_Os10g02544.1 upstream_gene_variant ; 1680.0bp to feature; MODIFIER silent_mutation Average:5.797; most accessible tissue: Callus, score: 12.423 N N N N
vg1000958635 T -> C LOC_Os10g02530.1 downstream_gene_variant ; 729.0bp to feature; MODIFIER silent_mutation Average:5.797; most accessible tissue: Callus, score: 12.423 N N N N
vg1000958635 T -> C LOC_Os10g02520-LOC_Os10g02530 intergenic_region ; MODIFIER silent_mutation Average:5.797; most accessible tissue: Callus, score: 12.423 N N N N
vg1000958635 T -> DEL N N silent_mutation Average:5.797; most accessible tissue: Callus, score: 12.423 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000958635 2.61E-07 NA mr1300 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000958635 2.04E-07 NA mr1310 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000958635 NA 1.27E-08 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000958635 4.17E-09 NA mr1926 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000958635 NA 3.77E-10 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251