\
| Variant ID: vg1000958635 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 958635 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCTACAATCGGCTAACATCTGTTGGTAGAAGGCGGCCGATTAGGTTAAATAGCAATATTAGCTTGGATTGTATAAAGTATCTACCACTCTATGAAACATC[T/C]
AGCAGCTTGATTGTCTAGATATTGTTCTTCTTTTCATACTTAATGCTGCATCAGTTGAGTTTGATCTATTAAGTCGTGCTTAGAATATCAATCTCTAGCC
GGCTAGAGATTGATATTCTAAGCACGACTTAATAGATCAAACTCAACTGATGCAGCATTAAGTATGAAAAGAAGAACAATATCTAGACAATCAAGCTGCT[A/G]
GATGTTTCATAGAGTGGTAGATACTTTATACAATCCAAGCTAATATTGCTATTTAACCTAATCGGCCGCCTTCTACCAACAGATGTTAGCCGATTGTAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.00% | 5.20% | 1.97% | 63.82% | NA |
| All Indica | 2759 | 3.50% | 0.20% | 2.90% | 93.40% | NA |
| All Japonica | 1512 | 81.00% | 9.10% | 0.20% | 9.72% | NA |
| Aus | 269 | 4.50% | 1.90% | 2.60% | 91.08% | NA |
| Indica I | 595 | 4.00% | 0.20% | 3.03% | 92.77% | NA |
| Indica II | 465 | 4.50% | 0.00% | 5.38% | 90.11% | NA |
| Indica III | 913 | 1.60% | 0.10% | 2.19% | 96.06% | NA |
| Indica Intermediate | 786 | 4.70% | 0.40% | 2.16% | 92.75% | NA |
| Temperate Japonica | 767 | 81.70% | 16.00% | 0.26% | 1.96% | NA |
| Tropical Japonica | 504 | 81.70% | 0.80% | 0.00% | 17.46% | NA |
| Japonica Intermediate | 241 | 77.20% | 4.10% | 0.41% | 18.26% | NA |
| VI/Aromatic | 96 | 1.00% | 88.50% | 0.00% | 10.42% | NA |
| Intermediate | 90 | 38.90% | 16.70% | 3.33% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000958635 | T -> C | LOC_Os10g02544.1 | upstream_gene_variant ; 1680.0bp to feature; MODIFIER | silent_mutation | Average:5.797; most accessible tissue: Callus, score: 12.423 | N | N | N | N |
| vg1000958635 | T -> C | LOC_Os10g02530.1 | downstream_gene_variant ; 729.0bp to feature; MODIFIER | silent_mutation | Average:5.797; most accessible tissue: Callus, score: 12.423 | N | N | N | N |
| vg1000958635 | T -> C | LOC_Os10g02520-LOC_Os10g02530 | intergenic_region ; MODIFIER | silent_mutation | Average:5.797; most accessible tissue: Callus, score: 12.423 | N | N | N | N |
| vg1000958635 | T -> DEL | N | N | silent_mutation | Average:5.797; most accessible tissue: Callus, score: 12.423 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000958635 | 2.61E-07 | NA | mr1300 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000958635 | 2.04E-07 | NA | mr1310 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000958635 | NA | 1.27E-08 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000958635 | 4.17E-09 | NA | mr1926 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000958635 | NA | 3.77E-10 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |