Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1000909798:

Variant ID: vg1000909798 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 909798
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGAATAGGAACCGGGACTAAAGATAATTTTTAGTTCTGGTTATTTTACCCAAGACTAGAGATAGATTCGTGGTCCTAGTTGTATAATCGGGACTATAT[G/A]
GGGTTACGAACCGTGAGTGAAAACCCTTTCACCAGTAGTGGTTTGACGTATTTATAAAAGCAATATATTAACCGGAGAACATCCGCCACGATTTCTCCAT

Reverse complement sequence

ATGGAGAAATCGTGGCGGATGTTCTCCGGTTAATATATTGCTTTTATAAATACGTCAAACCACTACTGGTGAAAGGGTTTTCACTCACGGTTCGTAACCC[C/T]
ATATAGTCCCGATTATACAACTAGGACCACGAATCTATCTCTAGTCTTGGGTAAAATAACCAGAACTAAAAATTATCTTTAGTCCCGGTTCCTATTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.90%	0.90%	1.46%	3.75%	NA
All Indica	2759	98.70%	0.00%	0.11%	1.16%	NA
All Japonica	1512	93.50%	2.80%	3.51%	0.13%	NA
Aus	269	44.20%	0.00%	4.46%	51.30%	NA
Indica I	595	99.00%	0.00%	0.00%	1.01%	NA
Indica II	465	99.60%	0.00%	0.00%	0.43%	NA
Indica III	913	99.50%	0.00%	0.00%	0.55%	NA
Indica Intermediate	786	97.20%	0.00%	0.38%	2.42%	NA
Temperate Japonica	767	88.90%	5.10%	6.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.00%	0.79%	0.00%	NA
Japonica Intermediate	241	96.30%	1.70%	1.24%	0.83%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	95.60%	0.00%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000909798	G -> A	LOC_Os10g02480.1	upstream_gene_variant ; 1754.0bp to feature; MODIFIER	silent_mutation	Average:60.343; most accessible tissue: Callus, score: 75.269	N	N	N	N
vg1000909798	G -> A	LOC_Os10g02480.2	upstream_gene_variant ; 1754.0bp to feature; MODIFIER	silent_mutation	Average:60.343; most accessible tissue: Callus, score: 75.269	N	N	N	N
vg1000909798	G -> A	LOC_Os10g02470.1	downstream_gene_variant ; 2776.0bp to feature; MODIFIER	silent_mutation	Average:60.343; most accessible tissue: Callus, score: 75.269	N	N	N	N
vg1000909798	G -> A	LOC_Os10g02470-LOC_Os10g02480	intergenic_region ; MODIFIER	silent_mutation	Average:60.343; most accessible tissue: Callus, score: 75.269	N	N	N	N
vg1000909798	G -> DEL	N	N	silent_mutation	Average:60.343; most accessible tissue: Callus, score: 75.269	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000909798	NA	5.44E-06	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000909798	NA	6.78E-09	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000909798	NA	7.71E-06	mr1045_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000909798	6.65E-06	4.70E-09	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000909798	NA	3.62E-07	mr1550_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000909798	2.81E-06	2.81E-06	mr1568_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000909798	NA	6.34E-08	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251